Received: January 01, 1970
Published: January 01, 1970
Genet.Mol.Res. ():

Keywords

Biological process; Bos indicus; Intramuscular fat; Lipid droplet; Variants; SNP

Introduction

Genetic variations in genes involved in the lipids storage in muscle may represent useful markers in marker-assisted selection programs, which may interfere with important phenotypic traits such as intramuscular fat deposition (IMF) in cattle. The main biological processes involved with IMF are adipogenesis (differentiation of adipocytes in preadipocytes) and lipogenesis (fat synthesis), controlled by different genes. Some of these genes are acetyl coenzyme-A carboxylase (ACC), adiponectin (adipoQ) e perilipin 2 (PLIN2) (Hoashi et al., 2008; McManaman et al., 2011), which were associated with the amount of body fat deposited in mammals. PLIN2 is a member of the PAT Family, which is involved in lipid droplet formation in the liver and some peripheral tissues. PLIN2 is also known as adipose differentiation-related protein (ADRP), or adipophilin, whose expression was detected in several cell types including fibroblasts, endothelial and epithelial cells and tissues, such as mammary gland and adrenal cortex, and can be used as a marker of cells lipid accumulation (Kimmel et al., 2010). Specifically, the PLIN2 gene encodes a 50 kD protein that is expressed in most tissues. It is involved in the uptake of long chain fatty acids and the formation and stabilization of lipid droplets (Brasaemle et al., 1997).

Previous studies have shown that the low expression of PLIN2 in mice fed a high-fat diet was associated with lower lipid accumulation in the liver (Imai et al., 2007). In studies with pigs Gandolfi et al. (2011) also reported that PLIN2 expression was associated with the availability of extracellular lipids to skeletal muscle cells. However, there is little information about genetic variation in PLIN2 of Nellore cattle (Bos indicus) and its association w 86 ith important traits such as intramuscular fat deposition.

Nellore breed is the most important breed raised in Brazil and is a Bos indicus species, which is genetically less predisposed to deposit intramuscular fat than Bos taurus species (Lehnert et al., 2007; Wang et al., 2009). The detection of markers that can be used in the future in the breeding program, as well, a better understanding of the genetic architecture of important traits such as IMF, is an important issue for beef quality and production. Thus, the main goal of this study was to identify and characterize SNPs in PLIN2 gene of Nellore cattle through a next-generation sequencing approach.

Materials and Methods

Animals

Six animals were used, three animals with the highest and three with the lowest estimated 99 genomic values (GEBVs) for the intramuscular fat traits measured in the Longissimus dorsi 100 muscle. These animals were selected based on data previously estimated and published by Cesar 101 et al. (2014).

Extraction of genomic DNA and primer design

Genomic DNA was previously extracted from blood samples, quantified and evaluated for quality, as described by Cesar et al. (2014). To design the primers, approximately 3 kb fragments of the PLIN2 gene were selected considering the size of the gene and the distance between the exons to cover the entire length of the gene including up and downstream regions.

To this end, five different primers were designed, with an overlap of at least 100 base pairs (bp) between the drawn primers. The design of the primers was performed based on the data deposited in NCBI from the program Primer 3 (http://109bioinfo.ut.ee/primer3-0.4.0/). The quality of the candidate sequences and the drawn primers were tested using the Net primer program (http://www.premierbiosoft.com). Subsequently, the best combination of forward and reverse primers (Table 1) was chosen. These were then tested using the BLAST tool (Basic Local Alignment Search Tool, http://blast.ncbi.nlm.nih.gov/Blast.cgi) for confirmation of similarity with the Bos indicus species and the desired region.

Primer Sequence (5'-3') amplicons (pb)
PLIN2_1 F 5’ TCACAGACTCAGCGGATCTTC 2692
PLIN2_1 R 5’ TTCGCCCGAATCCTCATTCA
PLIN2_2 F 5’ TTCCAACTCTGCTACTCCCC 2819
PLIN2_2 R 5’ TCTCCTGGCCTTTTCGCTTAG
PLIN2_3 F 5’ GCTTACTGTGTGCCAGGGAA 2839
PLIN2_3 R 5’ TCACAACATCCCTGAGCGTG
PLIN2_4 F 5’  CCTTCTGTCTGGTCTCCCCT 3337
PLIN2_4 R 5’  GACTCCTTGTGACCCACGGA
PLIN2_5 F 5' TCAAGTTTGTGCCTACATGCG 3585
PLIN2_5 R 5' CTCGGTGGCTATGCTTTCTTG

Table 1. Sequence and size of amplicons of each primer used.

Amplicons design

For the amplification of the fragment, a polymerase chain reaction (PCR) with each pair of primer designed was performed using the Veriti® thermal cycler (Applied Biosystems, USA). In general PCR amplification was performed under the following conditions: initial denaturation at 98°C for 30 seconds, followed by 30 cycles the in denaturation at 98°C for 10 seconds, annealing at 64°C for 30 seconds, and extension at 72°C for 3 minutes and ending with a final extension of 72°C for 3 minutes. All primer pairs followed the same amplification conditions. For PCR, 20 μl of the reaction containing 0.3 μM of each primer, the enzyme Taq polymerase Emeraldamp Max Hs (Takara Bio, USA) and 40-60 ng of the template DNA were used. Visualization and verification of the amplicon sizes were performed in 1% agarose gel electrophoresis.

Amplicons purification

The amplicons were purified by means of Agencourt AMPure XP magnetic beads (Beckman Coulter, USA), with the recommended volume of Agencourt AMPure XP (beads) for the sample volume, following the recommended by the manufacturer.

New generation sequencing and data analysis

For DNA libraries preparation, Nextera® XT DNA and Nextera® XT Index (Illumina, San Diego, USA) were utilized. In the first stage of libraries preparation the amplicons were fragmented by enzymatic reaction (transposomes) and simultaneously t 132 he adapters were added at their ends. Sequencing was performed on MiSeq platform (Illumina, San Diego, USA) using the MiSeq Reagent Kit v2 (500cycle), paired-end format (both directions of the DNA strand) and the size of 250 bases.

The quality of the sequencing data was analyzed and visualized through the FASTQ program version 0.11.5. The Seqyclean version 1.9.11 program was used to remove possible contaminant sequences (reference Univec database), reads with less than 200 bases and quality Phred score below 24. Finally, the mapping was performed using BWA software version 0.7.17 against the bovine reference genome (Bos taurus UMD3.1), formatted using the Picard program version 2.6.0 and the SNP calling was performed by the GATK 3.6 program using the haplotype caller option. The SNPs identified were filtered according to the quality parameters (QUAL> = 30, DP> = 10, QD> 2.0, FS> 60.0, MQ> 40.0, MQRankSum> -12.5 and ReadPosRankSum> -8.0).

Annotation of SNPs and identification of non-tolerable effects

After filtering, SNPs’ functional annotation was performed against the Bos taurus UMD3.1 reference genome from the Ensembl database release 94, using the VEP tool (Variant Effect Predictor, http://www.ensembl.org/info/docs/tools/vep/index.html) (McLaren et al., 2016). The aim of the annotation was to describe SNPs location in the genome (regions of exons, introns, intergenic, 3'UTR, etc.) consequence of mutation, classification based on the amino acid change (synonyms and non-synonyms) and possible effect on protein function. To predict whether the non-synonymous variants affect the protein function the Sorting Intolerant From Tolerant (SIFT) algorithm (Ng & Henikoff 2003) was used, which calculates a scaled probability (SIFT score) of observing a specific amino acid at a position from multiple sequence alignment of homologous proteins. When the score lies at or below the 0.05 threshold the variant is considered not tolerated and when the variant score lies 155 above the 0.05 threshold the variant is considered tolerated (Ng & Henikoff 2003).

The dataset supporting the conclusions of this article is available in the European Variants Archive (EVA) repository (EMBL-EBI), under accession PRJEB32049 and analyses ERZ857797. [https://www.ebi.ac.uk/eva/].

Results and Discussion

PLIN2 amplification and sequencing data

The genomic region that harbor PLIN2 gene (chr8: 25,129,104 – 25,143,157) was amplified by conventional PCR using four different primers from six different animals with extreme values of genomic estimated breeding value (GEBV). Three of the animals presented negative GBV (1:- 0.37, 2:-0.51, and 3:-0.29) and three others positive GEBV (4:0.65, 5:0.58, and 6:0.36) according previous report by Cesar et al., 2014. The purified PCR products from each sample were sequenced by next generation sequencing (NGS) technology. An average 587,401 reads were obtained per sample sequenced on the MiSeq Illumina equipment (Table 1). The number of reads remained after quality control for next analysis is shown in Table 2.

Samples Total paired reads Filtered paired read % mapped
1 592.017 459.774 99,97
2 565.105 430.339 99,96
3 676.562 556.401 99,97
4 526.290 432.374 99,98
5 581.042 471.076 99,98
6 583.390 465.397 99,97
Average 587.401 469.227 99,97

Table 2. Number of sequenced reads, number of reads after filtering by quality and percentage of reads mapped against the Bos taurus UMD3.1 reference genome

Mapping and variant calling

After sequencing quality control the reads were mapped against the Bos taurus UMD3.1 reference genome by the BWA program version 0.7.17. Approximately 99,97% of the reads could be mapped against the reference genome (Table 2). After mapping, the variants call file (single nucleotide polymorphism mutation, SNP) was filtered based on the criteria described in the methods section and 134 SNPs identified in the genomic region of PLIN2 gene (Table 3) remained for further analyzes.

Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Impact SIFT escore
ENSBTAT00000007519 Transcript intron - - - - - rs211354096 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs136804118 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs134646186 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs209373041 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs385469133 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs435698642 MODIFIER -
ENSBTAT00000007519 Transcript missense 83 17 6 A/V gCt/gTt rs42211560 MODERATE tolerated(0.48)
ENSBTAT00000007519 Transcript missense 173 107 36 R/T aGa/aCa rs210208890 MODERATE tolerated(1)
ENSBTAT00000007519 Transcript intron - - - - - rs110642789 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs432728074 MODIFIER -
ENSBTAT00000007519 Transcript synonymous 315 249 83 A gcG/gcC rs526432680 LOW -
ENSBTAT00000007519 Transcript intron - - - - - rs207950205 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs208905036 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs210835545 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs441730389 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs378037555 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs714278765 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs517717436 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs521330528 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs110913314 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs444288169 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs209399045 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs210640668 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs382930230 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs207761838 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs209175739 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs42211557 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs109476815 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs385408908 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs110813078 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs524038826 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs109604399 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs209772704 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs211315830 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs208237617 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs210014294 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs520676791 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs445402369 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs720282212 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs718135964 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs525728302 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - novel MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - novel MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs378048795 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs517524305 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs522575948 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs135601557 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs211374447 MODIFIER -
ENSBTAT00000007519 Transcript missense 845 779 260 S/I aGt/aTt rs208384595 MODERATE tolerated(1)
ENSBTAT00000007519 Transcript synonymous 942 876 292 I atC/atT rs452749834 LOW -
ENSBTAT00000007519 Transcript intron - - - - - rs29003298 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs209723770 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs211129329 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs208548211 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs526189285 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs523007446 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs516539011 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs518702411 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs523797990 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs520621411 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs525673063 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - novel MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs109319049 MODIFIER -
ENSBTAT00000007519 Transcript intron - - - - - rs109604007 MODIFIER -
ENSBTAT00000007519 Transcript missense 1009 943 315 R/W Cgg/Tgg rs380664726 MODERATE deleterious(0.02)
ENSBTAT00000007519 Transcript missense 1037 971 324 M/T aTg/aCg rs211616654 MODERATE tolerated(1)
ENSBTAT00000007519 Transcript 3_prime_UTR 1473 - - - - rs517357349 MODIFIER -
ENSBTAT00000007519 Transcript 3_prime_UTR 1513 - - - - rs475547389 MODIFIER -
ENSBTAT00000007519 Transcript 3_prime_UTR 1520 - - - - rs526133417 MODIFIER -
ENSBTAT00000007519 Transcript 3_prime_UTR 1530 - - - - rs436951898 MODIFIER -
ENSBTAT00000007519 Transcript 3_prime_UTR 1561 - - - - rs723640018 MODIFIER -
ENSBTAT00000007519 Transcript 3_prime_UTR 1568 - - - - rs720765170 MODIFIER -
ENSBTAT00000007519 Transcript 3_prime_UTR 1658 - - - - rs526483252 MODIFIER -
ENSBTAT00000007519 Transcript 3_prime_UTR 1721 - - - - rs134156974 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs444198535 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs518662331 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs457940957 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs717207897 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs715916715 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - novel MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs719680201 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs378030976 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs714897853 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs109635636 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs383602324 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs516337385 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs720814253 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs136058663 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs381247495 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs722632380 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs715647111 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs718800618 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs380766142 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs435953882 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs480639988 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs718606439 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs379015291 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs517660858 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs383073704 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs442840717 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs385666664 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs379498796 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs526840099 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs382278822 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs522255983 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs525839812 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - novel MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs519432893 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs523052825 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs526316656 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs445364212 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs385635983 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs465423583 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs479282671 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs383760961 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs385456901 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs718609977 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs378667654 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs524932854 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs381714647 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs383548143 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs378503632 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs381121857 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs384428775 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs468088848 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs380780082 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs385112421 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs717936043 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs721061727 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs133477686 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs519259007 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs437712488 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs716532519 MODIFIER -
ENSBTAT00000007519 Transcript downstream_gene - - - - - rs720000404 MODIFIER -

Table 3. Annotation of 134 SNPs identified on PLIN2 genomic region from Nellore steers, 328 according to region and consequence.

Variant effect prediction and annotation

Among the identified SNPs five are novel comparing to Ensembl database release 94. Three of them are in intronic regions and two in the downstream region (5 Kb), which are different of the novel SNPs recently reported by Yue and collaborators (2019). These authors also identified five novel variants using four different Chinese native breeds, which were annotated in exonic region and were associated with growth traits in.

The novel SNPs identified herein were classified as with moderate impact (non-disruptive variant that could change protein effectiveness) on variant consequence by the VEP tool (McLaren et al., 2010), which could promote severe consequences in transcripts and explain phenotypic differences among individuals.

Most of the variants are located in intronic and downstream gene (5 kb) regions (> 88%), eight percent in 3' UTR region of the gene, and seven percent in exonic region of PLIN2 gene (Table 4). More than 71% of the SNPs in exonic regions were classified as non-synonymous, which could play an important functional role in PLIN2 expression and consequently in differences on fat deposition. The non-synonymous variants correspond to the mutations of a nucleotide that can cause alteration of the translated amino acid and synonymous corresponds to the mutations of a nucleotide with no corresponding alteration of the translated amino acid (Hassan et al., 2018).

Variants Total number %
Total of identified SNPs 134 100.00
3' UTR region 8 5.97
Downstream gene region (5 kb) 60 44.78
Intron region 59 44.03
Exon region 7 5.22
  Exonic region  
Non-synonymous 5 71.43
Synonymous 2 28.57
  Non-synonymous SNPs  
Tolerated 4 80.00
Non-tolerated 1 20.00

Table 4. Number, region and estimated consequence of the variants identified on PLIN2 genomic region from Nellore steers by VEP tool.

Herein, the VEP tool was also used to predict the SIFT score of the five non-synonymous variants, which predicted that 80% of the non-synonymous variants are non-tolerated (Table 2). As is well known, PLIN2 is primarily expressed during the early process of adipocyte differentiation, which promotes fat droplet formation in muscle cells. Because of the importance of IMF quantity for meat flavor, tenderness, juiciness, ove 201 rall consumer acceptance, and human health (Killinger et al., 2004), the identification of the genetic architecture and the molecular mechanisms that control IMF deposition has become an important point for meat and human health research. As reported by our group, PLIN2 expression level was associated with trans-eQTL at chr3: 87,253,086 in Nellore cattle, which means that animals with different genotypes showed different expression level among the 193 animals (Cesar et al., 2018). However, in previous genome-wide association study we did not identify a significant association between this trans eQTL and intramuscular fat deposition using 286 animals from the same population (Cesar et al., 2014).

On the other hand, in pig population the authors revealed that PLIN2 gene expression analyses showed a positive correlation with higher intramuscular fat deposition (Davoli et al., 2011). Whereas in human, the PLIN2 overexpression has been shown to decrease the expression level of PPARa target genes as well as the transcriptional activity of mitochondrial genes (Bosma et al., 2012). This effect resulted in higher intramyocellular lipid storage, showing that genetic markers involved in IMF deposition could help to better understand of the biological processes involved in fat deposition, an important trait for beef quality and production (cost of production, feed convertion). As well as biological processes involved in metabolic diseases such as diabetes type 2 and obesity in humans.

The present study allowed the identification of possible causal mutations associated with the intramuscular fat deposition characteristic in the PLIN2 gene. However, the number of animals is a limiting factor to verify the importance of these mutations in the deposition of intramuscular fat among the animals tested. Because we could not achieve association with good accuracy with small number of animals, so the present work had the main goal identify putative mutations in PLIN2 gene, which allow future association studies in the same or different population.

Conclusion

This is the first study performed to identify novel variants of SNP type in PLIN2 gene in Nellore cattle, which is an important gene for IMF, using next generation sequencing. Herein, we could identify five novel variants of SNP type in PLIN2 genomic region, which can potentially change the protein effectiveness and could be used as genomic markers in animal breeding program. However, further association studies are necessary to verify if these novel SNPs are associated with fat deposition traits in Nellore cattle.

Acknowledgments

This work was supported by the EMBRAPA (Macroprograma 1, 01/2005); São Paulo Research Foundation - FAPESP [grant numbers 2014/11871–5, 2014/22884–0, 2012/23638–8, and 2016/26030-1]; National Council for Scientific and Technological Development – CNPq [grants from Luiz L Coutinho and Luciana CA Regitano].

Conflict of Interest

The authors confirmed that there is no conflict of interests.

About the Authors

Corresponding Author

References

  • Brasaemle DL, Barber T, Wolins NE, Serrero G, et al. (1997) Adipose differentiation-related protein is an ubiquitously expressed lipid storage droplet-associated protein. J Lipid Res 38: 2249-2263.
  • Bosma M, Hesselink MK, Sparks LM, Timmers S, et al. (2012) Perilipin 2 improves insulin sensitivity in skeletal muscle despite elevated intramuscular lipid levels. Diabetes 61: 2679-2690. https://doi.org/10.2337/db11-1402
  • Cesar AS, Regitano LC, Mourão GB, Tullio RR, et al. (2014) Genome-wide association study for intramuscular fat deposition and composition in Nellore cattle. BMC Genetics  15: 39. https://doi.org/10.1186/1471-2156-15-39
  • Cesar ASM, Regitano LCA, Reecy JM, Poleti MD, et al. (2018) Identification of putative regulatory regions and transcription factors associated with intramuscular fat content traits. BMC Genomics 19: 499. https://doi.org/10.1186/s12864-018-4871-y
  • Davoli R, Gandolfi G, Braglia S, Comella M, et al. (2011) New SNP of the por- cine perilipin 2 (PLIN2) gene, association with carcass traits and expression analysis in skeletal muscle. Mol Bio Rep  38: 1575-1583. https://doi.org/10.1007/s11033-010-0266-0
  • Gandolfi G, Mazzoni M, Zambonelli P, Lalatta-Costerbosa G, et al. (2011) Perilipin 1 and perilipin 2 protein localization and gene expression study in skeletal muscles of European cross-breed pigs with different intramuscular fat contents. Meat Science 88: 631-637. https://doi.org/10.1016/j.meatsci.2011.02.020
  • Hassan MS, Shaalan AA, Dessouky MI, Abdelnaiem AE, et al. (2018) Evaluation of computational techniques for predicting non-synonymous single nucleotide variants pathogenicity. Genomics  S0888-7543(18)30180-0. https://doi.org/10.1016/j.ygeno.2018.05.013
  • Hoashi S, Hinenoya T, Tanaka A, Ohsaki H, et al. (2008) Association between fatty acid compositions and genotypes of FABP4 and LXRalpha in Japanese Black cattle. BMC Genetics 9:84. https://doi.org/10.1186/1471-2156-9-84
  • Imai Y, Varela GM, Jackson MB, Graham MJ, et al. (2007) Reduction of hepatosteatosis and lipid levels by an adipose differentiation-related protein antisense oligonucleotide. Gastroenterology 132:1947-1954. https://doi.org/10.1053/j.gastro.2007.02.046
  • Killinger KM, Calkins CR, Umberger WJ, Feuz DM, et al. (2004) Consumer sensory acceptance and value for beef steaks of similar tenderness, but differing in marbling level. Journal os Animal Science  82: 3294-3301. https://doi.org/10.2527/2004.82113294x
  • Kimmel AR, Brasaemle DL, McAndrews-Hill M, Sztalryd C, et al. (2010) Adoption of PERILIPIN as a unifying nomenclature for the mammalian PAT-family of intracellular lipid storage droplet proteins. J Lipid Res; 51: 468-471. https://doi.org/10.1194/jlr.r000034
  • Lehnert SA, Reverter A, Byrne KA, Wang Y, et al. (2007) Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds. BMC Developmental Biology 7: 95. https://doi.org/10.1186/1471-213x-7-95
  • McLaren W, Pritchard B, Rios D, Chen Y, et al. (2010) Deriving the consequences of genomic variants with the Ensembl API and SNP Effect Predictor. Bioinformatics  26: 2069-2070. https://doi.org/10.1093/bioinformatics/btq330
  • McManaman JL, Bales ES, Orlicky DJ, Jackman M, et al. (2011) Perilipin-2-null mice are protected against diet-induced obesity, adipose inflammation, and fatty liver disease. J Lipid Res 54:1346-1359. https://doi.org/10.1194/jlr.m035063
  • Ng PC and Henikoff S (2003) SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Research 31: 3812-3814. https://doi.org/10.1093/nar/gkg509
  • Wang YH, Bower NI, Reverter A, Tan SH, et al. (2009) Gene expression patterns during intramuscular fat development in cattle. Journal of Animal Science 87: 119-130. https://doi.org/10.2527/jas.2008-1082
  • Yue B, Wu J, Shao S, Zhang C, et al. (2019) Polymorphism in PLIN2 gene and its association with growth traits in Chinese native cattle. Animal Biotechnology 5:1-6. https://doi.org/10.1080/10495398.2018.1555166

Download:
Full PDF