All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
Research Article

Development and characterization of microsatellite molecular markers for the eye mask frog Batrachyla taeniata (Girard, 1855)

Received: April 12, 2019
Accepted: April 27, 2019
Published: May 05, 2019
Genet.Mol.Res. 18(2):

Keywords

Batrachyla taeniata; Microsatellites; ION Torrent; fragment analysis.

Introduction

Batrachyla taeniata (Anura: Batrachylidae) is a small frog species endemic to the temperate forests of Nothofagus that has a wide distribution in Chile and marginally in Argentina. In Chile, it extends from the Aconcagua province in the Valparaíso region to the Capitán Prat province in the Aysén region (Salaberry et al., 1981; Brieva and Formas 2001; Correa et al., 2014). In addition, it presents island distributions in at least three islands near the continent, Quiriquina, Mocha and Chiloé (Salaberry et al., 1981). This species is of particular interest from a biogeographical point of view, since it has been found in two different ecological regions: the Mediterranean and Oceanic regions (di Castri, 1976) covering approximately more than 1,500 km from north to south. In its northern distribution is associated with hydrophilic coastal relict forests and mesophiles (ej: Zapallar y Quintero) surrounded by semi-arid vegetation and in the southern distribution with humid and shady forests in environments saturated with humidity (Cei, 1962; Formas, 1979). This species has been frequently reported from Concepción to the south, in contrast to the populations in central Chile where is less frequent and more geographically isolated (Correa et al., 2014). The populations of central Chile (Quintero) present high values of distance and genetic differentiation with respect to the populations of the southern distribution group (Brieva and Formas, 2001). The species has been categorized as “Least Concern” in the International Union for Conservation of Nature (IUCN) red list (2015), despite the fact that Chilean law considers it "Almost Threatened" by the Classification Regulation of Species (RCE) (2014) because northern populations are more affected by the change in land use, deforestation and human settlement. These modifications in the landscape can have a strong effect on the patterns of dispersion and genetic flow of the species, this due to that amphibians have a restricted dispersion capacity that tends to promote differentiation (Duellman, 1999; Funk et al., 2005). For this reason, they show a greater genetic structure in their populations compared to other groups of species (Semlitsch et al., 2008).

The microsatellites are a type of molecular marker widely used in population genetics, conservation biology and evolutionary biology (Abdul-Muneer, 2014). These correspond to fragments of DNA sequence that consist of tandem repetitions of basic units that vary between 1 to 10 nucleotides in length and are repeated throughout the genome (Hamada et al., 1982; Vieira et al., 2016). The genetic variation of many microsatellite loci is characterized by high heterozygosity and polymorphisms (Litt and Luty, 1989; Ellegren, 2004), being a versatile tool for the identification of genetically deteriorated populations (Arif et al., 2011). Consequently, the use of this type of DNA markers can help to establish better management and protection plans for the conservation of biological populations. In the present study, we developed 25 microsatellite markers for B. taeniata with the purpose of using them in future population studies to investigate the genetic structure and diversity of their populations for conservation purposes.

Materials and Methods

Samples

For the study DNA samples was obtained of specimens coming from Hualpén Botanic Park (36°47’S; 73°09’W), surroundings Hualpén (36°47’S; 73°05’W) Concepción, river headboard Tubul (37°12’S; 73°32’W) La Cal (37°12’S; 73°31’W) Arauco, Chile.

DNA preparation, sequencing and obtaining microsatellite markers

Through optimizations of Kit Promega Wizard Purification Systems, we extracted DNA of 27 individuals of B. taeniata from the sampled localities for use in the isolation of microsatellite loci. By quantifying DNA, we select 8 samples from different locations to perform the massive sequencing. The initial amount of DNA used was 100 ng, quantified spectrophotometrically (Nanodrop) and fluorimetrically (Qubit). DNA fragmentation at 400 bp was performed with the Covaris S220 sonicator. The DNA fragment library was constructed using the Ion Xpress Plus gDNA Fragment Library Kit (Thermo Scientific, manual MAN0009847, review C.0). For the preparation of library, emulsion and chip sequencing, the manufacturer's protocols were followed without modifications (Thermo Scientific, P.N. MAN0009847 revision D.0, MAN0010902 revision A.0 and MAN0009816 revision D.0). The readings in Fastq format were filtered using the Prinseq program (Schmieder and Edwards, 2011). The readings that passed the filters were transformed to Fasta format and were clustered at 90% identity by CD-HIT (Li et al., 2001). Subsequently, the MISA program (MISA webpage) was used for the identification and localization of dinucleotide microsatellites with at least 6 repetitions and tri /tetra-nucleotides with at least 5 repetitions. The identification of the primers was done with Primer3 (Rozen and Skaletsky, 2000) with a range in amplicon size between 100-500 bp and an optimum of 350 bp, length of the primer of 19-25 bp with an optimum of 21 bp, Melting Temperature (TM) between 53-57°C with an optimum of 55°C and a GC percentage between 30-80%.

Cell culture and treatment of βTC6 cells, Cell viability assay

Of the 221 repetitive motifs obtained, 60 pairs of primers were selected, and these were tested for amplification using DNA from 10 individuals. PCR amplifications were performed in a total volume of 8 uL containing 10X Buffer Taq (Thermo Scientific), 25 mM MgCl2 (Thermo Scientific), 2.5 mM dNTPs (Promega), 10 uM of each primer (Macrogen), 0.5 U uL-1 Taq DNA Polymerase (Thermo Scientific) and ca. 100 ng uL-1 DNA. The thermocycler conditions for all the loci was with an initial denaturation of 5 min at 95°C, followed by 20 cycles of 30 s 95°C, 30 s at the optimum annealing temperature of 65-55°C and a final extension of 30 s at 72°C. In each cycle, the temperature was decreased in 0.5°C and the following conditions were continued: 30 s of denaturation at 95°C, 30 s of annealing at 55°C, 30 s of extension at 72°C and a final extension of 5 min at 72°C.

The PCR products were separated by 2.5% electrophoresis in agarose gels (BM-0120 Winkler), which ran between 60 min and 90 min. A first approximation of the microsatellite loci was estimated with the molecular weight marker Bench Top 100 pb DNA ladder (Promega).

For fragment analysis, 30 pairs of primers were selected, which were marked with four fluorophores (6FAM, PET, VIC, and NED). The selected microsatellites were amplified again using DNA from 40 individuals from the locality of Hualpén with the same initial conditions. The PCR products were run on an Applied BioSystems 3730 DNA Analyzer sequencer in Advanced Analysis Center, University of Guelph, Canada.

Statistical Analyses

Alleles were scored using the PeakScanner version 1.0 (Applied Biosystems). The number of alleles (A), Size the range of observed alleles in base pairs (bp), number of individual genotyped (N), observed heterozygosity (Ho), expected heterozygosity (He) and inbreeding coefficient (FIS) were tested for by using GenALEx 6.5 (Peakall and Smouse, 2006). Tests for deviations from the Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium were made in GENEPOP v 4.5 (Rousset, 2008). We also compare the structure of two populations separated by urbanization in the locality of Concepción in the Structure v 2.3.4 software (Pritchard et al., 2010) with the 11 most polymorphic microsatellites developed in this work.

Results

Twenty-five of the pairs of primers tested amplified high-quality PCR products that exhibited polymorphisms. The characteristics of the loci are reported in Table 1. Most of the microsatellite primers contained dinucleotide and tetranucleotide repeat units. The number of alleles (A) varied between 2 and 23 (mean, 9.52). The sizes of the alleles varied between 110 to 268 bp, the heterozygosity observed (Ho) varied between 0.21 and 1.00 (mean, 0.71) and the expected heterozygosity (He) between 0.21 and 0.93 (mean, 0.68).

Locus Repeat motif Primer sequences (5'-3') A Size (bp) N Ho He F IS GenBank Accession No
LocBat1 (AT)7 F: TTTCTTCCTATAGACCAGTG
R: GGTATTGAGGCTACATCTTA
13 162-180 39 0.410 0.801 0.488 **  
LocBat4 (CA)9 F: GATACCAGGTAATTGTTGC
R: ACCTGCTACTTCCTCTATTT
10 110-130 29 0.414 0.587 0.296 **  
LocBat12 (GA)14 F: GAATAAAGCCAGTGTGAAC
R: GTAAAGGACCCTTAGAAAAG
21 123-164 40 0.900 0.919 0.021  
LocBat17 (AT)11 F: GGGGACACTTTATAATCAG
R: AATGACAGACGTCAGTAGAC
10 142-161 34 0.676 0.854 0.208 **  
LocBat9 (TA)8 F: CTAATAACGTAAGTGCAACC
R: GTTGTAACGAGTAAGTCCAT
8 171-220 34 0.441 0.510 0.136 **  
LocBat14 (AT)9 F: ATGTGCTCACAGAAGAAAG
R: GATATACACCCTTGGTCCT
5 135-144 39 0.923 0.625 -0.477  
LocBat27 (TGC)8 F: GGACTGAATGTTCTTGTAGT
R: ATTAAACTGTTCTAGGAGGC
22 132-169 39 0.846 0.922 0.083  
LocBat18 (TAA)8 F: GATTACTTCAGTGCTAGTCAG
R: TAGAGCTATTTGATCAGAGG
15 200-235 38 0.737 0.869 0.152  
LocBat19 (TAC)7 F: TACAGTTACCAAGAGTCCC
R: GATAGCAAGGTTAGTGGTAA
8 150-166 39 0.641 0.757 0.153 **  
LocBat20 (CTG)7 F: GTTGAGACCACAAATCAAG
R: TTAGTTGGAGTCTCTAATGC
2 188-191 40 1.000 0.500 -1.000  
LocBat7 (AC)9 F: CAATACATCAGACTTTCTCC
R: TATTTGGTCCTAGTGAAGAG
9 154-167 34 0.765 0.726 -0.054  
LocBat22 (TCC)7 F: CTGTGTACATTTTCTTGGG
R: GAGCAGATGCTTGTATCTAT
2 129-135 40 1.000 0.500 -1.000  
LocBat25 (CAT)9 F: CTAACATAGTGGTCATGGAT
R: CATATTCACTAAAGCAGAGC
13 137-165 36 0.667 0.815 0.182 **  
LocBat36 (TAGA)9 F: AGAGATAAGGAAAGTTGGG
R: CCATCTATCTACCTAACTCCTA
6 116-140 40 0.625 0.494 -0.266  
LocBat43 (AT)8 F: TGTACCTCACCTAAGAAAGA
R: GGAAGGGAATAATACTTCTG
17 164-180 38 0.395 0.897 0.560 **  
LocBat31 (AGTT)10 F: TAGATCTCAACAGGAACAAG
R: AGGTTAGACTTTTAAGCCAC
13 129-188 32 0.563 0.855 0.342 **  
LocBat37 (GTCT)6 F: AGATAGGAGCTTTAGGATTC
R: GTACTCTGAAGTTGTGGTAAC
3 132-137 40 1.000 0.620 -0.613  
LocBat34 (ATAG)6 F: ATACAGACTCAAAGTGTCGT
R: CCACCAATGTTAGTTTACC
23 177-268 40 0.975 0.933 -0.045  
LocBat52 (CTG)5 F: TAAATACCCATGTAGTCCAG
R: AATTTCTTACCCGCTACTC
2 137-144 39 0.974 0.500 -0.950  
LocBat51 (GA)7 F: TCCAGTTAGATAAGCGTTAC
R: ACATATAGCACTTCTACCCTC
6 172-179 39 0.205 0.214 0.040  
LocBat53 (CTG)6 F: CCTTTCTGATGCTACACTAC
R: TAGTTTGGAGTCTCTAATGC
3 248-251 36 1.000 0.514 -0.947  
LocBat54 (ATA)6 F: GGCTCTATTGATGACAATC
R: CTCTGTAAGTCTGCTTTTGT
14 126-159 38 0.921 0.881 -0.046  
LocBat55 (ATT)6 F: TACCTACATGGGATGATTAC
R: GTCAATCCAAGTTAGTTGC
4 122-135 29 0.207 0.599 0.655 **  
LocBat 56 (AGG)6 F: CTACTGTGTCAAGCTGATAAC
R: TAGTGTAGCTGCTGTGTGTAT
6 142-158 30 0.600 0.734 0.182 **  
LocBat59 (GTCT)6 F: AGATAGGAGCTTTAGGATTC
R: CTCTGAGTTGTGGTAACCT
3 129-133 39 1.000 0.500 -1.000  

Table 1: Characterization of microsatellites for Batrachyla taeniata.

We found evidence of deviations of HWE for 10 microsatellite loci, linked to high inbreeding coefficients (FIS), indicating a loss of heterozygosity in those particular loci. The inbreeding coefficient values were significantly different from zero (p < 0.05) with negative FIS value detected for the loci LocBat 14, LocBat 20, LocBat7, LocBat22, LocBat36, LocBat37, LocBat34, LocBat52, LocBat53, LocBat54, and LocBat59, indicating that the population possess a greater number of heterozygotes in those particular loci, supported by the observed heterozygosity values (Ho).

There was no linkage disequilibrium found within the microsatellite loci tested through the sequential Bonferroni correction. Nevertheless, significant deviations from the HWE expectations in the population reflected the occurrence of heterozygote deficiency.

Genetic summary statistics of eleven microsatellite loci from for two population of B. taeniata (Table 2) show that in both populations the Ho was less than He (average Ho = 0.699: He = 0.832 and Ho = 0.627: He = 0.807). The values of the inbreeding coefficient were low for both populations, however, the population of the city of Hualpén shows a higher number of loci with high FIS (average FIS = 0.239).

Locus Hualpén botanic park (N=30) Hualpén city (N=10)
A Ho He FIS A Ho He FIS
LocBat1 11 0.414 0.761 0.456 7 0.400 0.780 0.487
LocBat4 8 0.435 0.542 0.197 6 0.333 0.694 0.520
LocBat12 18 0.867 0.901 0.038 13 1.000 0.905 -0.105
LocBat17 8 0.640 0.811 0.211 7 0.778 0.827 0.060
LocBat27 18 0.931 0.903 -0.031 8 0.600 0.840 0.286
LocBat18 15 0.793 0.866 0.084 8 0.556 0.809 0.313
LocBat25 12 0.643 0.798 0.195 8 0.750 0.797 0.059
LocBat43 16 0.464 0.893 0.480 8 0.200 0.825 0.758
LocBat31 13 0.640 0.864 0.259 5 0.286 0.673 0.576
LocBat34 23 0.967 0.935 -0.034 11 1.000 0.890 -0.124
LocBat54 13 0.900 0.878 -0.025 8 1.000 0.836 -0.196
Average 14 0.699 0.832 0.167 8 0.627 0.807 0.239

Table 2: Genetic summary statistics of eleven microsatellite loci from two locations of Batrachyla taeniata in Concepción

The genetic distance value of Nei among the population of Hualpén botanic park and Hualpén city was from 0.416. However, the estimates in STRUCTURE indicate that the best K value for both previously separated groups is 1 (Table 3), indicating the presence of a single population (likelihood values k = 1: -2194.5, k = 2: -2276.2, k = 3: -3081.4).

K Ln prob. of data Mean value of Ln likelihood Variance of Ln likelihood
1 -2194.5 -2161.5 66.0
2 -2276.2 -2090.6 371.2
3 -3081.4 -2039.2 2084.5

Table 3: Estimate of the best value of K in STRUCTURE software

Discussion

The advances in the massive sequencing have allowed great advantages for the development of molecular markers of microsatellite type (Sung-Yin et al., 2018; Zhang et al., 2018). These markers are one of the most widely explored genetic markers in several research areas due to their robustness and high polymorphism (Senan et al., 2014; Zhuang et al., 2017) and are an excellent tool to know the structure of natural populations and help the conservation of the species (Mu-Yeong et al., 2017; Nakahama et al., 2018).

A good model for investigating the genetics structure of wild animal populations areamphibians (Beebee, 2005), because are highly dependent on their habitat (Duellman and Trueb, 1994) with relatively low dispersal capacities (Jehley and Arntzen, 2002). In addition, their populations show a greater genetic structure with respect to other groups (Johns and Avise, 1998), giving rise to populations that can represent unique genetic entities, between relatively short geographic distances (Jehle and Artzen, 2002; Beebee, 2005).

The genetic variability of a natural population is important for its continuity over time (Lacy, 1997), like its genetic structure, therefore, the combination of ecological and genetic data can help identify the factors that limit the size of the population and determine the potential conservation of them (Liu et al., 2013). However, these studies are not yet represented in the conservation efforts for Chilean amphibians’ populations. Despite the advantages of microsatellite markers for population analysis, only a few species count on their development and characterization, including Pleurodema thaul (D’elía et al., 2014), Rhinoderma darwinii (Fuentes et al., 2014), Telmatobufo bullocki (Moreno-Puig et al., 2014), Telmatobius chusmisensis (Fabres et al., 2018).

In this study, we developed for the first time a set of twenty-five polymorphic microsatellites for B. taeniata. As seen in the results, the number of alleles (A) varied between 2 and 23 (mean, 9.52), finding highly polymorphic alleles such as those reported in P. thaul where the number of alleles per locus varied between 7 and 22 (D’elía et al., 2014). As mentioned, the heterozygosity observed (Ho) varied between 0.21 and 1.00 (mean, 0.71), with higher values per locus than reported in P. thaul (D’elía et al., 2014), R. darwinii (Fuentes et al., 2014), T. bullocki (Moreno-Puig et al., 2014) and T. chusmisensis (Fabres et al., 2018).

In this work was no linkage disequilibrium found within the microsatellite loci tested through the sequential Bonferroni correction. Nevertheless, significant deviations from the HWE expectations in the population reflected the occurrence of heterozygote deficiency, which can be given because of high inbreeding within the population, a scenario that has been demonstrated in other Chilean amphibians (Fuentes et al., 2014).

As mentioned, the genetic structure of populations is not always reflected in the geographical proximity of individuals (Evanno et al., 2005). However, in the analysis carried out for individuals of B. taeniata from two locations separated by high human urbanization, they show that they still correspond to the same population (the best k = 1). This indicates that individuals still share ancestry of the same ancestral population, perhaps due to a recent temporary separation of the analyzed localities.

Conclusion

It is important to advance in the development of obtaining genetic information from this species to improve strategies and prioritize the conservation of their populations, especially the northern populations that are more affected by the change in land use, deforestation and human settlement. In summary, we report twenty-five microsatellite markers in B. taeniata identified by massive sequencing. These microsatellite markers represent a valuable resource for future population analysis for conservation purposes.

Acknowledgments

The first author thanks the CONICYT Doctoral Scholarship 2012 and the National Doctorate Scholarship for operational expenses 21120202. The Agricultural and Livestock Service is thanked for the exempt resolution nº:6494/2006, 1470/2009, 3350/2015 and Universidad de Concepción, Diuc Semilla Patagonia. 205.113.066-1 and CA-099.09.

Conflict of Interest

The authors declare no conflict of interest.

About the Authors

Corresponding Author

Ingrid Cisternas-Medina

Laboratorio de Sistemática y Conservación de Herpetozoos, Departamento de Zoología, Universidad de Concepción, Concepción, Chile

Email:
[email protected]

References

  • Abdul-Muneer PM (2014) Application of microsatellite markers in conservation genetics and fisheries management: recent advances in population structure analysis and conservation strategies. Genet Res Int 2014: 1-11. https://doi.org/10.1155/2014/691759
  • Arif IA, Khan HA, Bahkali AH, Al Homaidan AA, et al. (2011) DNA marker technology for wildlife conservation. Saudi J Biol Sci 18: 219-225. https://doi.org/10.1016/j.sjbs.2011.03.002  
  • Beebee TJC (2005) Conservation genetics of amphibians. Heredity 95: 423-427. https://doi.org/10.1038/sj.hdy.6800736
  • Brieva LM and Formas JR (2001) Allozyme variation and geographic differentiation in the Chilean leptodactylid frog Batrachyla taeniata (Girard, 1854). Amphib-Reptil 22: 413-420. https://doi.org/10.1163/15685380152770372
  • Cei JM (1962) Batracios de Chile. Ediciones Universidad de Chile, Santiago. CVIII + 128 pp.
  • Correa C, Cisternas J, Velásquez N, Lobos G, et al. (2014) Distribution extension, new records and historical occurrence of Batrachyla taeniata (Girard, 1854) (Anura: Batrachylidae) in Chile. Herpetol Notes 7: 703-706.
  • D’elía G, Beasley RR, Lance SL, Jones KL, et al. (2014) Development of polymorphic microsatellite markers for the Pleuroderma thaul. Conserv Genet Resour 6: 747-749. https://doi.org/10.1007/s12686-014-0206-8
  • Di Castri F and Hajek E (1976) Bioclimatología de Chile. Ediciones Universidad Católica de Chile. Lira 140 Santiago, Chile. 128 pp.
  • Duellman WE (1999) Patterns of Distribution of Amphibians: A Global Perspective. The Johns Hopkins University Press, Baltimore and London. 633 pp.
  • Duellman WE. and Trueb L (1994) Biology of Amphibians. The Quarterly Review of Biology 69: 532-532. https://doi.org/10.1086/418798
  • Ellegren H (2004) Microsatellites: simple sequences with complex evolution. Nat Rev Genet 5: 435-445. https://doi.org/10.1038/nrg1348
  • Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software structure: A simulation study. Mol Ecol 14: 2611-2620. https://doi.org/10.1111/j.1365-294x.2005.02553.x
  • Fabres A, Fibla P, Araya C, Sallaberry M, et al. (2018) Development and characterization of 22 polymorphic microsatellites of the Andean frog Telmatobius chusmisensis (Anura, Telmatobius) and cross amplification in seven Chilean species of the genus. Mol Biol Rep 45: 1533-1538. https://doi.org/10.1007/s11033-018-4228-2  
  • Formas JR (1979) The South American Herpetofauna: Its origen, evolution, and dispersal (ed: Duellman, W. E.), pp. 314-379. Museum of Natural History, University of Kansas, Monograph 7, Lawrence, Kansas. https://doi.org/10.5962/bhl.title.3207 
  • Fuentes-Navarrete M, Gómez-Uchida D, Gallardo-Escarate C, Canales-Aguirre C, et al. (2014) Development of microsatellites for Southern Darwin’s frog Rhinoderma darwinii (Duméril & Bibron, 1841). Conserv Genet Resour 6: 1035-19037. https://doi.org/10.1007/s12686-014-0279-4
  • Funk WC, Blouin MS, Corn PS, Maxell BA, et al. (2005) Population structure of Columbia spotted frogs (Rana luteiventris) is strongly affected by the landscape. Mol Ecol 14: 483-496. https://doi.org/10.1111/j.1365-294x.2005.02426.x
  • Jehle R and Artzen W (2002) Review: microsatellite markers in amphibian conservation genetics. Herpetol J 12: 1-9.
  • Johns GC and Avise JC (1998) A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Mol Biol Evol 15: 1481-1490. https://doi.org/10.1093/oxfordjournals.molbev.a025875
  • Hamada H, Petrino MG, Kakunaga T (1982) A novel repeated element with Z-DNA-forming potential is widely found in evolutionarily diverse eukaryotic genomes. PNAS 79: 6465-6469. https://doi.org/10.1073/pnas.79.21.6465
  • IUCN SSC Amphibian Specialist Group (2015) Batrachyla taeniata. The IUCN Red List of Threatened Species. https://doi.org/10.2305/iucn.uk.2015-4.rlts.t56334a79812277.en
  • Lacy RC (1997) Importance of Genetic Variation to the Viability of Mammalian Populations.  J Mamal 78: 320-335. https://doi.org/10.2307/1382885
  • Li W, Jaroszewski J, Godzik A (2001) Clustering of highly homologous sequences to reduce the size of large protein database. Bioinformatics 17: 282-283. https://doi.org/10.1093/bioinformatics/17.3.282
  • Litt M and Luty JA (1989) A hypervariable microsatellite revealed by in vitro amplification of dinucleotide repeat within the cardiac muscle actin gene. Am J Hum Genet 44: 397-401.
  • Liu Y, Webber S, Bowgen K, Schmaltz L, et al., (2013) Environmental factors influence both abundance and genetic diversity in a widespread bird species. Ecol Evol 3: 4683-4695. https://doi.org/10.1002/ece3.856
  • MISA – MIcroSAtellite identification tool. https://doi.org/10.1093/benz/9780199773787.article.b00123495 
  • Moreno-Puig V, Yildirim Y, Brunton DH (2014) Development of microsatellite markers for the critically endangered frog Telmatobufo bullocki and cross-species amplification in two related species. Conserv Genet Resour 6: 883-884. https://doi.org/10.1007/s12686-014-0231-7
  • Mu-Yeong L, Hea CM, Hey SJ, Eui-Geun S, et al. (2017) Characterization of 33 microsatellite markers and development of multiplex PCR for yellow-throated marten (Martes flavigula). Genet Mol Res 17: gmr16039854.
  • Nakahama N, Ito O, Kaneko S, Matsuki Y, et al. (2018) Development of microsatellite markers for the endangered orchid Calanthe izu-insularis (Orchidaceae). Genes Genet. Syst. 93: 31-35. https://doi.org/10.1266/ggs.17-00021
  • Peakall R and Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6: 288-295. https://doi.org/10.1111/j.1471-8286.2005.01155.x
  • Pritchard JK, Wen X, Falush D (2010) Documentation for Structure software: Version 2.3. Department of Human Genetics. University of Chicago, USA.
  • Rousset F (2008) GENEPOP’007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour. 8: 103-106. https://doi.org/10.1111/j.1471-8286.2007.01931.x
  • Rozen S and Skaletsky H (2000). Primer3 on the WWW for General Users and for Biologist Programmers. Bioinformatics Methods and Protocols. Humana Press, New Jersey, 365-386. https://doi.org/10.1385/1-59259-192-2:365
  • Salaberry M, Valencia J, Diaz N (1981). Distribución y ambiente de Batrachyla taeniata (Girard) en Chile (Anura - Leptodactylidae). Bol Mus Nac Hist Nat 38: 61-67.
  • Schmieder R and Edwards R (2011) Quality control and preprocessing of metagenomic datasets. Bioinformatics 27: 863-864. https://doi.org/10.1093/bioinformatics/btr026
  • Semlitsch R and Skelly D (2008) Ecology and Conservation of Pool-Breeding Amphibians. In: Calhoun AJK, deMaynadier PG (eds) Science and conservation of vernal pools in northeastern North America. CRC Press, Boca Raton, pp 127-148.
  • Senan S, Kizhakayil D, Sasikumar B, Sheeja TE (2014) Methods for Development of Microsatellite Markers: An Overview. Not Sci Biol 6: 1-13. https://doi.org/10.15835/nsb.6.1.9199
  • Sung-Yin Y, Wai-Ling F, Wenhua SCh, Chia-Min H, et al. (2018) Development of Novel Polymorphic Microsatellite Markers in Catch Bowl Coral, Isopora palifera (Scleractinia; Acroporidae) Using Next-generation Sequencing. Zool Stud 57: 32
  • Vieira MLC, Santini L, Diniz AL, Munhoz CF (2016). Microsatellite markers: what they mean and why they are so useful. Genet Mol Biol 39: 312-328. https://doi.org/10.1590/1678-4685-gmb-2016-0027
  • Zhang F, Wang Y, Xu M, Wei L, et al. (2018). Development and characterization of twenty-eight polymorphic microsatellite for rice field eel (Monopterus albus) using RAD tag sequencing. Genet Mol Res 17: gmr16039880. https://doi.org/10.4238/gmr16039880
  • Zhuang YF, Wang ZF and Wu LF (2017) New set of microsatellites for Chinese tallow tree, Triadica sebifera. Genet. Mol Res 16: gmr16029624.

Keywords:
Download:
Full PDF