All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
Research Article

Characterization of Genetic Diversity and Linkage Disequilibrium of ZmNAC33 in Maize

Received: January 02, 2018
Accepted: February 18, 2018
Published: February 20, 2018
Genet.Mol.Res. 17(1): gmr16039879
DOI: 10.4238/gmr16039879

Abstract

The maize NAC gene, encoding a NAC domain transcription factor, plays vital roles in the growth process of maize under abiotic stresses. To investigate the response of ZmNAC33 to salinity stress, we analyzed the expression of the ZmNAC33 gene in roots and leaves of three-leaf stage seedlings among maize inbred lines. The result showed that the expression of ZmNAC33 was up-regulated in the salinity tolerant inbred line Ji853 and down-regulated in the salinity susceptible inbred line Chang7-2. The cDNA and the full sequence from maize inbred line Ji853 were amplified to analyze genetic structure. ZmNAC33 gene comprises three exons and two introns. We compared genetic diversity of ZmNAC33 among 69 elite maize inbred lines, a total of 144 sequence variants, including 113 SNPs and 31 Indels. Neutrality tests were negative selection by Tajima’s D and Fu and Li’s test. Analysis of polymorphism sites showed that at least 28 recombination’s have occurred. This finding provides insight into the development of breeding programs, germplasm management and association genetic studies.

Introduction

Environmental stress conditions are major factors limiting growth, productivity, and the distribution of plants in the world, especially, salinity and drought (De Oliveira et al. 2011). Growth process of maize is frequently impacted by salinity and drought, so improving drought and salinity tolerance is an important goal in breeding programs (Liu et al. 2013). The molecular mechanisms underlying plant adaptation to drought and salinity stresses have been researched intensively, and transcriptional regulation of gene expression play an important role in this process (Mao et al. 2016). Some have been used as targets for engineering stress tolerance in plants. When plant was subjected to abiotic stresses, the expression of some important functional proteins wasregulated by transcription factors (TFs). TFs can regulate the expression of target genes through binding to specific cis-acting elements in the promoters of stress-related genes (Fan et al. 2014, Shao et al. 2015).

NAC (NAM, ATAF1/2, CUC2) transcription factors family is a plant-specific transcription factor superfamily and not only associated with diverse biological processes, including shoot apical meristem development and response to many biotic stress, but also, they have a key function in abiotic stress tolerance inclusive drought and salinity (Ernst et al. 2004, Golldack et al. 2011). NAC domain genes represent one of the key regulatory gene families involved in plant development and abiotic stress responses (Wu et al. 2009, Zheng et al. 2009, Wei et al. 2016). Detailed phylogenetic analysis has reveal that ZmNAC33 belonged to stress-responsive group (ZmNAC33 was different number in different article) (Fan et al. 2014, Shiriga et al. 2014, Peng et al. 2015), which included ZmSNAC1 (Lu et al. 2012), ZmNAC55 (Mao et al. 2016), ZmNAC111 (Mao et al. 2015). When AtNAC genes of Arabidopsis and ZmNAC genes were used to constructed phylogenetic tree, the stress- group included ANAC2, ANAC19, ANAC32, ANAC55, ANAC72, ANAC81, ANAC102 (Fan et al. 2014).

OsNAC genes of rice and ZmNAC genes were used to construct phylogenetic tree, the stress-group included OsNAC3, OsNAC5, OsNAC6, OsNAC88 (Fan et al. 2014). The expression of ANAC2, ANAC19, ANAC55, ANAC72 induced by NaCI, drought, over-expression of Arabidopsis plant showed significantly increased drought and salinity tolerance (Fujita et al. 2004, Tran et al. 2004, Wu et al. 2009, Zhu et al. 2015, Liu et al. 2016). ANAC2 in Arabidopsis was homologous gene of ZmNAC33, it indicated that ZmNAC33 gene would play a vital role in response to abiotic stresses.

In rice, OsNAC5 and OsNAC6 were stress-responsive NAC gene, the transgenic plants enhanced significantly tolerances to multiple abiotic stresses (Nakashima et al. 2012, Puranik et al. 2012). NAC genes were specifically up- regulated in the drought tolerance line Han21 but maintained an unaltered expression level in the drought susceptible line Ye478 using Affymetrix Maize Genome Array (Zheng et al. 2010). Genotyping method especially genetic diversity of candidate gene makes the SNPs and Indels more attractive as genetic marker. An indel of ZmNAC111 sequence variants in the promoter region was found by sequenced entire sequence of ZmNAC111 gene from TST maize inbred lines, the indel as a marker was confirmed in the three bi-parental F2:3 populations (Mao et al. 2015). However, no report on studies have addressed expression of ZmNAC33 gene under salinity stress and the genetic diversity of the ZmNAC33 is not known yet, a study of the genetic diversity of ZmNAC33 gene in the relevant maize germplasm would provide a better understanding of the genetic diversity.

In this study, we cloned transcription factor ZmNAC33 gene and chose 69 elite maize inbred lines in the Northeast region of China. The expression of ZmNAC33 gene under salinity treatment, which was responsive to salinity stress, was characterized. We analyzed genetic diversity of ZmNAC33 gene in the 69-elite maize inbred lines and described haplotype diversity and recombination events in this gene in maize.

Material and Methods

Collection ZmNAC proteins and AtNAC proteins

To identify members of maize NAC transcription factor gene family, multiple database searches were performed. The online Plant Transcription Factor Database (TFDB) (http://planttfdb.cbi.pku.edu.cn/), maize genetics and genomics database (http://www.maizegdb.org/), the Plant Genomics Resource (https://phytozome.jgi.doe.gov/pz/portal.html#!info?alias=Org_Zmays), Gramene database (http://ensembl.org/Zea_mays/Info/Index), National Centre for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) were used to search for NAC genes. We gathered NAC genes in maize by using keywords (NAC, NAM) and domain (PF02365) search. All maize ZmNAC genes were confirmed by Pfam (http://pfam.sanger.ac.uk/) and SMART (http://smart.embl-heidelberg.de/). To order to collect Arabidopsis thaliana NAC gene family, we used the Plant Transcription Factor Database (http://planttfdb.cbi.pku.edu.cn/family.php?sp=Ath&fam=NAC)to search for Arabidopsis thaliana. As a query sequence, we used maize NAC protein to BLASTP program.

Phylogenetic analysis and sequence alignment

All ZmNAC proteins were aligned by means of Clustal W, and all ZmNAC sequences were checked manually to remove redundant sequences. Phylogenetic trees were constructed by using ZmNAC protein, and an uprooted tree was generated by ClustalX version 2.1 (Thompson et al. 1997) by the neighbour-joining (NJ) method with the pairwise-deletion option and the Poisson correction. Bootstrap analysis was performed using 1000 replicates. The tree was analyzed and displayed by using MEGA software version 5. Another two uprooted trees were constructed by the same method to align ZmNAC and AtNAC protein.

Expression analysis of ZmNAC33 under salinity treatment

Gene expression patterns can provide important clues for determining gene function. We carried out qRT-PCR analysis of ZmNAC33 gene subjected to salinity stress. Two maize inbred lines, Ji853 (salt tolerant) and chang7-2 (salt susceptible), were used. The seeds were sown into pots containing vermiculite in a greenhouse under normal conditions. Plants in the three-leaf stage were subjected to salt treatment. Seedlings were subjected to 200 mM NaCl, shoots and roots were harvested separately at the time points indicated, then immediately frozen in liquid nitrogen and stored at -70°C. Total RNA was isolated using TRIZOL reagent. The concentration of total RNA was estimated using a Nanodrop 1000 (Thermo Scientific product, USA).

Quantitative real-time PCR was used to quantify ZmNAC33 expression for real-time RT-PCR, 2 μg of total RNA was reverse transcribed into first-strand cDNA with M-MLV reverse transcriptase (Trans) according to the manufacturer’s protocol. A mixture of PCR reaction components was prepared according to the manufacturer’s protocol of the SYBR Premix Ex TaqTM. Thermocyclin and fluorescence detection were performed with Quant Studio™ 6 (Applied Biosystems). PCR was performed using a two-step method: 94°C for 30s, followed by 40 cycles of 94°C for 10 s and 60°C for 30 s. The relative expression level was determined based on the 2-ΔΔCT method (K.J. Livak 2001) by using maize 18S rRNA as an internal control. The primers for real-time PCR are listed in Table 1.

Primers Sequence (5’→3’) PCR product (bp)
1F (DNA) CGCGCGTCCGTCCAAGAAAC 1287
1R (DNA) TGTAGATGCGGCACAGGACCCAG
2F (DNA) ACCGTGCCCAATGATTCGAC 1538
2R (DNA) TATCAACGTGTTCAGTGTCTCGC
3F (cDNA) CAGCAGGGAGGAACACGATGAG 1078
3R (cDNA) TGCCGCCTCTCCATGTAATC
4F (qPCR) CCAAGGGCGAGAAGACCAACT 132
4R(qPCR) CGCCGCCCTTCTTGTTGTAG
18S rRNA-F CCTGCGGCTTAATTTGACTC 174
18S rRNA-R GTTAGCAGGCTGAGGTCTCG  

Table 1: Primers designed for PCR amplification of cDNA and genomic sequence of ZmNAC33

ZmNAC33 isolation and sequence analysis

We performed a search of the ZmNAC33 ID (accession No. GRMZM2G014653) in the maize sequence database (http://www.maizesequence.org),and found a corresponding genome sequence in B73. Specific primers were designed to amplify the full-length cDNA sequence ZmNAC33 from the maize inbred line Ji853. Two pairs were designed from the sequence of B73 inbred line to produce overlapping fragments covering 2385 bp from Ji853, which contained 5’UTR region, coding region, intron and 3’UTR region. All primer sequences are listed in Table 1. Extracted and purified PCR products by sequencing. The PCRs were carried out as follows: 5 min at 94°C; 35 cycles of 30s at 94°C, 30 s at 60°C, and 1 min at 72°C; and then 10 min at 72°C. The Contig Express software (version 6.0) was used to assemble sequences.

Plant materials and sequencing ZmNAC33 gene

A total of 69 maize inbred lines were used to construct elite maize inbred lines (Table S1). These inbred lines represented most of the genetic diversity available to breeding and research programs in the Northeast region of China. DNA was extracted from fresh leaf tissues of 3-week inbred lines after germination using the Maxi CTAB method (Saghai-Maroof MA 1984). Sequences of ZmNAC33, including the 5’- and 3’-untranslated regions (UTRs), were sequenced from the maize elite inbred lines. Two pairs of primers of ZmNAC33 were designed using inbred line Ji853 gene sequence. PCR reactions were carried out in 50 μl volumes under the following conditions: 100 ng template DNA, 250 nM of each primer, 250 nM dNTPs, 2 U Taq polymerase and 250 μM MgCI2. Reaction were performed as follows: an initial 94°C denaturation step for 5 min followed by 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 90 s. The final extension step was followed by 72°C incubation for 10 min. Amplified DNA fragments were sequenced.

Sequence variation analysis for ZmNAC33 gene

The sequences were assembled using Contig Express software. Full alignments were built for ZmNAC33 gene by using default settings of the CLUSTALX program (Thompson et al. 1997). The software DNASP version 5 (Rozas et al. 2003) was used to analyze the nucleotide diversity (π) and average number of nucleotide differences (k) within each group and each defined region. The neutrality of the polymorphisms of ZmNAC33 was analyzed by using Tajima’s D statistical test (Tajima 1989) and Fu and Li’s statistical tests (Fu and Li 1993).

Recombination events, haplotype, and salinity tolerance of elite maize inbred lines

DNASP soft was used to analyze the haplotype diversity among ZmNAC33 gene based on the amplified sequences of the elite maize inbred lines. Recombination events of ZmNAC33 gene among these inbred lines were estimated with the methods developed by Hudson and Hey (Hudson and Kaplan 1985). To estimate salinity tolerance, the 69-elite maize inbred lines were salinity treatment 100 mmol/L NaCl, the five-appropriate physiological and biochemical indices were tested and used to evaluate salinity tolerance, which included germination percentage, relative conductivity, SOD activity, MDA content and proline content (Yang et al. 2011).

Results

Identification of ZmNAC family and AtNAC family and phylogenetic analysis

The keywords (NAC, NAM) and domain (PF02365) were regarded as a query to search five public databases: NCBI, TFDB, maize DB, phytozome, and Gramene. Therefore, there were at least 214 ZmNAC genes. By removing redundant sequences from the five databases, the longest protein sequence was selected if a single ZmNAC was subject to differential splicing. Then the putative protein sequences of ZmNAC were confirmed by Pfam and SMART searches for the presence of the NAC domain. After removing duplicate sequences and identification of Pfam and SMART, a total of 133 ZmNAC genes were identified. The number of NAC proteins in maize is greater than in Arabidopsis (105 members).

To clarify the phylogenetic relationships among the ZmNAC genes and AtNAC genes, multiple alignment, and phylogenetic analyses of the proteins of ZmNAC and AtNAC were performed using ClustalX 2.1 and MEGA 5 software. An unrooted tree was constructed to examine the phylogenetic relationships.

To classify subgroups and identify the evolutionary relationships between ZmNACs and AtNAC, phylogenetic analysis was performed (Figure 1). Most of stress-responsive NAC could be classified into the same groups. Studies have shown that at least 10 NAC genes, ZmNAC111 (Mao et al. 2015), ZmNAC1 (Lu et al. 2012), ZmNAC70 (Mao et al. 2016), AT1G69490 (ANAC029), AT1G52890 (ANAC019), AT3G15500 (ANAC055), AT4G27410 (RD26), AT1G77450 (ANAC032), AT5G63790 (ANAC102), AT1G01720 (ANAC2) (Wu et al. 2009, Le et al. 2011). In the QTL of salinity resistance in maize, ZmNAC33was candidate gene among these candidate genes of the QTL. ZmNAC33was up-regulated 18-fold in the maize drought tolerant inbred line (HKI577), ZmNAC33 was ZmNAC 51 (Shiriga et al. 2014). Therefore, ZmNAC33 was identified to play a role in maize under salt stress.

linkage-disequilibrium-domain-proteins

Figure 1: Phylogenetic analysis of maize and Arabidopsis NAC domain proteins

Induced ZmNAC33 expression by salinity stress

To investigate the response of ZmNAC33 to salinity stress, we performed qRT-PCR using RNA isolated from NaCI treated maize inbred lines Ji853 and Chang7-2. The result showed that the expression of ZmNAC33 was induced significantly by high salinity (200 mM NaCI) and was up-regulated in the salinity tolerant inbred line Ji853 and down-regulated in the salinity susceptible inbred line Chang 7-2 (Figure 2). ZmNAC33 transcript level increased gradually in leaves and roots, the relative level of ZmNAC33 expression increased by more than 6-fold in roots.

linkage-disequilibrium-salinity-treatment

Figure 2: The expression patterns of ZmNAC33 gene under high salinity treatment

Cloning ZmNAC33 gene

We cloned ZmNAC33 gene from maize inbre line Ji853. Overlapping sequences of 2385 bp was generated through reference sequence of B73. When aligned with reference sequence of cDNA sequence, ZmNAC33 gene is composed of 3 exons spaced by 2 introns with 2385 bp in total (Figure 3), which spanned the 5’-UTR (283bp) to the 3’-UTR region (750 bp). The full length open reading frame (ORF) of ZmNAC33 is 882 bp, and encodes a polypeptide of 292 amino acid residues. Sequence alignment revealed that ZmNAC33 contains a typical NAC structure with a conserved NAC domain. The nucleotide sequences of the maize ZmNAC33 gene in inbred line Ji853, whose genome has been sequenced, were used as the references to amplify the sequences of this gene in 69 inbred lines.

linkage-disequilibrium-Schematic-diagram

Figure 3: Schematic diagram showing two sets of primers based on the reference sequence of ZmNAC33

ZmNAC33 genetic diversity

Sequence polymorphisms were analyzed among 69 maize inbred lines across 2385 bp of sequence, which includes a 5’ untranslated region (UTR), a coding region, a intron region, and a 3’ UTR. The SNPs and indel of ZmNAC33 gene were identified and summarized (Table 2). From genomic sequences of ZmNAC33 gene of the elite inbred lines, a total of 113 SNP sites and 31 indel were identified, revealing the frequency of SNPs and indels (1 SNP every 21.1 bases and 1 indel every 76.9 bases on average). The frequency of SNPs was highest in the 3’UTR region, intron region was second subsequencely, but the frequency of indels was highest in the intron region. The frequencies of SNP and indel in the coding region were less than other region, one SNP occurred every 58.2 bp in the coding region. Polymorphism analysis found the frequency of SNPs higher than indels.

Parameters 5’-UTR Coding region Intron 3’-UTR Entire region
Total length of amplicons (bp) 283 815 537 750 2385
Number of all sequence variants (SNPs and indels) 16 18 45 65 144
Frequency of all sequence variants 0.0565 0.0221 0.0838 0.0867 0.0604
Number of SNPs 14 14 34 51 113
Frequency of SNPs per bp 0.0495 0.0172 0.0633 0.068 0.0474
Number of indels 2 4 11 14 31
Frequency of indels per bp 0.0071 0.0049 0.0205 0.0187 0.013

Table 2: Summary of the frequency of polymorphisms of ZmNAC33 gene

From the elite maize inbred lines, the entire nucleotide diversity of ZmNAC33 gene was 0.01469 (Table 3), followed by the 5’-UTR region (πU0.02382), coding regions (π=0.00598), intron regions (π=0.2264) and the 3’-UTR region (ing regions Among 4 regions of ZmNAC33 gene, the coding region showed much lower nucleotide polymorphism than others, while the intron region showed the highest frequency of all sequence region. The result was caused because of the number of SNPs, it had the highest frequency of SNPs per bp. Most of the nucleotide changes in the intron regions and the 3’-UTR regions.

Regions 5’-UTR Exon Intron 3’-UTR Total
S 22 26 41 173 238
π 0.02382 0.00598 0.02264 0.02661 0.01469
k 6.454 4.792 10.483 17.614 32.266
D 1.26008 -0.35923 0.74645 -1.77318 -1.2169
D* 1.37946 -1.50212 0.15291 -5.03434* -3.87249*
F* 1.59187 -1.28962 0.45283 -4.46225* -3.35412*

Table 3: Summary of nucleotide diversity and divergence in each region of ZmNAC33 in maize

The neutrality of the polymorphisms of ZmNAC33 was evaluated by Tajima’s D test and Fu and Li’s D* and F* test. Separate Tajima’s D tests for each region (5’-UTR, exon, intron and 3’-UTR) revealed positive and non-significant departures from the expectation, but significant deviation in the 3’-UTR and the entire gene sequence from the neutral expectation (P<0.05) occurred with the Fu and Li D* and F* tests (Table 3). When the 3’-UTR regions were excluded, the results of Fu and Li D* and F* tests were positive and non-significant. It might easily change in the 3’-UTR regions. These results could not reject the hypothesis, a lack of footprint of positive selection in most region of ZmNAC33 was suggested. The sliding window analysis of Tajima’s D showed that the elite maize inbred lines had both positive and negative values at different regions of ZmNAC33 gene (Figure 4). Negative D values were detected in the 5’UTR region (70-126 bp), exon1 (333-358 bp), intron1 (472 bp), exon2 (675 bp, 750-838 bp), intron2 (941-1020 bp, 1139-1209 bp), exon3 (1259-1284 bp, 1365-1421 bp, 1497-1523 bp, 1624-1649 bp), 3’UTR (1996-2452 bp). These regions are mainly located in the exon3 region. The observed pattern of variability under the neutral different from expected variability, Tajima’s D test was not significant.

linkage-disequilibrium-Tajima

Figure 4: Tajima

The full-length sequence of ZmNAC33 in the elite inbred lines contained 238 segregating sites. However, most of segregating sites were detected across the region of 3’-UTR region. Moreover, the 3’-UTR region showed higher nucleotide diversity (of segregating sites were detected across the region of 3’-UTR region.

Evidence of recombination, haplotype diversity and salinity tolerance of elite maize inbred lines

The polymorphic sites in the entire ZmNAC33 sequence were used to analyze the evidence of recombination. According to Hudson and Kaplan, at least 28 recombination events were found to be responsible to the polymorphism of ZmNAC33 gene. The recombination events were analyzed in the informative sites of every region, there was one in the 5’-UTR positions and between and intron2 and exon3, respectively. There were two in the positions between 5’-UTR and intron1, there were five in the positions between intron1 and intron2, there were nineteen in the 3’-UTR positions.

Based on the entire sequence of ZmNAC33 gene sequence sequenced in 69 maize inbred lines, a total of 34 haplotypes were detected with a Hd equal to 0.9646. The tested elite maize inbred lines were unbalanced distributed in these haplotypes. Among the haplotypes identified in this analysis, the most frequent haplotype was Haplotype2 and Haplotype3, which contained 7 maize inbred lines, respectively, 19 contained only one maize inbred line. In addition, we also noticed that two frequent haplotypes, including Haplotype9 and Haplotype19, contained 5 maize inbred lines, respectively. Haplotype10 and Haplotype21 contained 4maize inbred lines, respectively. Others contained 2 maize inbred lines, respectively. In the CDS region, 16 were synonymous sites, and the other 10 were non-synonymous sites. In the CDS region of the maize ZmNAC33 gene, a total of 4 indels were identified. When we translated the CDS region into amino acid sequence, one indel could result in frame shift during translation some of elite maize inbred lines, the code appeared stop code in advance.

Based on results of physiological and biochemical indices, there were 5 inbred lines with high salinity tolerance, 15 inbred lines with salinity tolerance, 32 inbred lines with medium salinity tolerance, 10 inbred lines with susceptible tolerance, 7 inbred lines with high susceptible (Table S1). Combined to haplotypes and salinity tolerance, inbred line Ji853 belonged to the Haplotype3, which consisted salinity tolerance. It included 1 high salinity tolerance inbred line, 4 medium salinity tolerance inbred lines, 2 salinity tolerance inbred lines. The Haplotype19 also consisted salinity tolerance inbred lines.

Discussion

TFs play important roles in the regulation of gene expression in response to salinity and drought stresses, and their molecular engineering is proposed as a potential strategy for the genetic improvement of stress tolerance in crop (Mao et al. 2015). When we analyzed expression of ZmNAC33 gene by qRT-PCR in the tolerance inbred line and susceptible inbred line, the result showed that ZmNAC33 gene appeared higher expression under salinity stress in tolerant inbred line than that in the susceptible inbred line. When maize inbred line HKI577 (drought tolerant) and HKIPC3-3 (drought susceptible) were drought treatment, ZmNAC33 expression was up-regulated in the drought tolerant inbred line HKI577 and down-regulated in the drought susceptible inbred line HKIPC3-3(Shiriga et al. 2014). The expression showed that ZmNAC33 gene response abiotic stress. Its homologous gene of Arabidopsis NAC, AtNAC2, was induced by drought, high salinity, abscisic acid (ABA) and overexpression plants in Arabidopsis remarkably enhanced plant tolerance to drought (Wu et al. 2009).

The nucleotide polymorphisms of ZmNAC33 gene were a non-significant difference in the frequencies analyzed among 5’UTR, CDS, intron and 3’ UTR region. Because Tajima’s D test for the total sequence and every region were also not significant, this suggests that the population is evolving as predicted by infinite site models. Both the entire length of the ZmNAC33 sequence and every region had positive Tajima’s D values, indicating that a deficiency in the number of low frequency alleles in the population could be the result of a demographic process. Based on the non-significant results of the Tajima’s D test, selection might not act on the ZmNAC33 gene. Although nucleotide polymorphisms of RSUS3 gene showed that Tajima’s D test was not significant, 2 markers based on the indel and SNP found by haplotypes and genetic diversity (Lestari et al. 2009, Lestari et al. 2011).

The identification of SNPs and indels associated with resistance phenotype would be helpful for developing resistant varieties (Kadam et al. 2016). The nucleotide variations of ZmNAC33 gene in the 69-elite maize inbred lines identified 34 different haplotypes, however, Haplotype3 and Haplotype19 contained salinity tolerance inbred lines. GmSALT3 gene of soybean was divided into 5 haplotypes, two indels were found salinity tolerance and salinity susceptible haplotypes (Guan et al. 2014). Nucleotide polymorphism is a major origin of heritable phenotypic variation, the abundant genetic diversity is the foundation for crop improvement. Sequence polymorphism of TaGW2-6Agene was analyzed by sequenced 207 Indian wheat, association of these SNPs and that of the corresponding haplotypes identified a novel SNP, the SNP was converted into CAPS (Cleaved Amplified Polymorphism Sequences) marker to distinguish the alleles of TaGW2-6A (Jaiswal et al. 2015). We analyzed the genetic diversity and the haplotype diversity of ZmNAC33 gene, which was induced expression by drought and salinity treatment. The nucleotide polymorphisms of ZmNAC33 gene would be helpful in identifying alleles for further genetic analysis, the nucleotide polymorphism of ZmNAC33 gene would allow for more effective markers development and can be prospective for breeding program. Hence, the nucleotide polymorphism might be prospective and useful as marker assisted selection.

Conclusion

The study revealed that the expression of ZmNAC33 was induced in salinity treatment. ZmNAC33 gene includes three exons and two introns. A total of 113 SNP and Indels were obtained from 69 maize inbred lines. The results of Tajima’s D and Fu and Li’s test showed that neutrality of ZmNAC33 was not significant in population. Combined to haplotypes and salinity tolerance, the Hap_3 belonged to salinity tolerance, it included 1 high salinity tolerance inbred line, 4 medium salinity tolerance inbred lines, 2 salinity tolerance inbred lines.

Acknowledgments

The study was conducted with financial support from Agricultural Science and Technology Innovation Program of Jilin Province, Discovery of excellent germplasms and cultivation of inbred lines suitable for mechanized harvesting in maize and the Key Project of Science and Technology Department of Jilin Province “The creation of maize lines for alkali tolerance by GWAS and QTL mapping”.

Conflicts of interest

None declared.

About the Authors

Corresponding Author

Xiaohui Li

Crop Germplasm Resources Institute, Jilin Academy of Agricultural Sciences, Gongzhuling 136100, P.R. China

Email:
[email protected]

References

  • De Oliveira TM, Cidade LC, Gesteira AS, Coelho Filho MA, et al. (2011). Analysis of the NAC transcription factor gene family in citrus reveals a novel member involved in multiple abiotic stress responses. Tree Genetics & Genomes. 7: 1123-1134. https://doi.org/10.1007/s11295-011-0400-8 
  • Ernst HA, Olsen AN, Larsen S, Lo Leggio L (2004). Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Rep. 5: 297-303. https://doi.org/10.2210/pdb1ut4/pdb 
  • Fan K, Wang M, Miao Y, Ni M, et al. (2014). Molecular evolution and expansion analysis of the NAC transcription factor in Zea mays. PLoS ONE. 9, e111837. https://doi.org/10.1371/journal.pone.0111837 
  • Fu YX and Li WH (1993). Statistical tests of neutrality of mutations. Genetics. 133: 693-709.
  • Fujita M, Fujita Y, Maruyama K, Seki M, et al. (2004). A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 39: 863-876. https://doi.org/10.1111/j.1365-313x.2004.02171.x 
  • Golldack D, Luking I, Yang O (2011). Plant tolerance to drought and salinity: stress regulating transcription factors and their functional significance in the cellular transcriptional network. Plant Cell Rep. 30: 1383-1391. https://doi.org/10.1007/s00299-011-1068-0 
  • Guan RX, Qu Y, Guo Y, Yu L, et al. (2014). Salinity tolerance in soybean is modulated by natural variation in GmSALT3. Plant Journal. 80: 937-950. https://doi.org/10.1111/tpj.12695 
  • Hudson RR and Kaplan NL (1985). Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics. 111: 147-164.
  • Jaiswal V, Gahlaut V, Mathur S, Agarwal P, et al. (2015). Identification of novel SNP in promoter sequence of TaGW2-6A associated with grain weight and other agronomic traits in wheat (Triticum aestivum L.). PLoS ONE. 10, e0129400. https://doi.org/10.1371/journal.pone.0129400 
  • K.J. Livak TDS (2001). Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCT method, Methods. 25: 402–408.
  • Kadam S, Vuong TD, Qiu D, Meinhardt CG, et al. (2016). Genomic-assisted phylogenetic analysis and marker development for next generation soybean cyst nematode resistance breeding. Plant Sci. 242: 342-350. https://doi.org/10.1016/j.plantsci.2015.08.015 
  • Le DT, Nishiyama R, Watanabe Y, Mochida K, et al. (2011). Genome-wide survey and expression analysis of the plant-specific NAC transcription factor family in soybean during development and dehydration stress. DNA Res. 18: 263-276. https://doi.org/10.1093/dnares/dsr015 
  • Lestari P, Ham TH, Lee HH, Woo MO, et al. (2009). PCR marker-based evaluation of the eating quality of japonica rice ( Oryza sativa L.). J Agric Food Chem. 57: 2754-2762.
  • Lestari P, Lee G, Ham TH, Reflinur, et al. (2011). Single nucleotide polymorphisms and haplotype diversity in rice sucrose synthase 3. J Hered. 102: 735-746. https://doi.org/10.1093/jhered/esr094 
  • Liu S, Wang X, Wang H, Xin H, et al. (2013). Genome-wide analysis of ZmDREB genes and their association with natural variation in drought tolerance at seedling stage of Zea mays L. PLoS Genet. 9, e1003790. https://doi.org/10.1371/journal.pgen.1003790 
  • Liu Y, Sun J, Wu Y (2016). Arabidopsis ATAF1 enhances the tolerance to salt stress and ABA in transgenic rice. J Plant Res. 129: 955-962. https://doi.org/10.1007/s10265-016-0833-0 
  • Lu M, Ying S, Zhang DF, Shi YS, et al. (2012). A maize stress-responsive NAC transcription factor, ZmSNAC1, confers enhanced tolerance to dehydration in transgenic Arabidopsis. Plant Cell Rep. 31: 1701-1711. https://doi.org/10.1007/s00299-012-1284-2 
  • Mao H, Wang H, Liu S, Li Z, et al. (2015). A transposable element in a NAC gene is associated with drought tolerance in maize seedlings. Nat Commun. 6: 8326.  https://doi.org/10.1038/ncomms9326 
  • Mao H, Yu L, Han R, Li Z, et al. (2016). ZmNAC55, a maize stress-responsive NAC transcription factor, confers drought resistance in transgenic Arabidopsis. Plant Physiol Biochem. 105: 55-66. https://doi.org/10.1016/j.plaphy.2016.04.018 
  • Nakashima K, Takasaki H, Mizoi J, Shinozaki K, et al. (2012). NAC transcription factors in plant abiotic stress responses. Biochim Biophys Acta. 1819: 97-103.
  • Peng X, Zhao Y, Li X, Wu M, et al. (2015). Genomewide identification, classification and analysis of NAC type gene family in maize. J Genet. 94: 377-390. https://doi.org/10.1007/s12041-015-0526-9 
  • Puranik S, Sahu PP, Srivastava PS, Prasad M (2012). NAC proteins: Regulation and role in stress tolerance. Trends Plant Sci. 17: 369-381. https://doi.org/10.1016/j.tplants.2012.02.004 
  • Rozas J, Sanchez-Delbarrio JC, Messeguer X, Rozas R (2003). DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 19: 2496-2497. https://doi.org/10.1093/bioinformatics/btg359 
  • Saghai-Maroof Ma SK, Jorgensen Ra, Allard Rw (1984). Ribosomal DNA spacer-length polymorphism in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc Natl Acad Sci USA. 81: 8014–8018. https://doi.org/10.1073/pnas.81.24.8014 
  • Shao H, Wang H, Tang X (2015). NAC transcription factors in plant multiple abiotic stress responses: Progress and prospects. Front Plant Sci. 6: 902. https://doi.org/10.3389/fpls.2015.00902 
  • Shiriga K, Sharma R, Kumar K, Yadav SK, et al. (2014). Genome-wide identification and expression pattern of drought-responsive members of the NAC family in maize. Meta Gene. 2: 407-417. https://doi.org/10.1016/j.mgene.2014.05.001 
  • Tajima F (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 123: 585-595.
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, et al. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876-4882. https://doi.org/10.1093/nar/25.24.4876 
  • Tran LS, Nakashima K, Sakuma Y, Simpson SD, et al. (2004). Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell. 16: 2481-2498. https://doi.org/10.1105/tpc.104.022699 
  • Wei S, Gao L, Zhang Y, Zhang F, et al. (2016). Genome-wide investigation of the NAC transcription factor family in melon (Cucumis melo L.) and their expression analysis under salt stress. Plant Cell Rep. 9: 1827-1839. https://doi.org/10.1007/s00299-016-1997-8 
  • Wu Y, Deng Z, Lai J, Zhang Y, et al. (2009). Dual function of Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res. 19: 1279-1290. https://doi.org/10.1038/cr.2009.108 
  • Yang S, Zhang C, Piao M, Zhao Z, et al. (2011). Analysis on salt and alkaline tolerance of sixty-nine maize inbred lines at seed ling stage. Seed. 30: 1-6.
  • Zheng J, Fu J, Gou M, Huai J, et al. (2010). Genome-wide transcriptome analysis of two maize inbred lines under drought stress. Plant Mol Biol. 72: 407-421. https://doi.org/10.1007/s11103-009-9579-6 
  • Zheng X, Chen B, Lu G, Han B (2009). Overexpression of a NAC transcription factor enhances rice drought and salt tolerance. Biochem Biophys Res Commun. 379: 985-989. https://doi.org/10.1016/j.bbrc.2008.12.163 
  • Zhu X, Chen J, Xie Z, Gao J, et al. (2015). Jasmonic acid promotes degreening via MYC2/3/4- and ANAC019/055/072-mediated regulation of major chlorophyll catabolic genes. Plant J. 84: 597-610. https://doi.org/10.1111/tpj.13030 

Keywords:
Download:
Full PDF