All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
Research Article

Identification of Colletotrichum isolates from Capsicum chinense in Amazon

Published: June 29, 2017
Genet.Mol.Res. 16(2): gmr16029601
DOI: 10.4238/gmr16029601

Abstract

Chili pepper (Capsicum chinense) is a great economic important culture on the State of Amazonas, and it represents, approximately, a production of 1.9 thousand tons per year. It is one of the hosts of Colletotrichum genus in the North region of Brazil. The aim of the study was to differentiate and to identify isolates of Colletotrichum collected from C. chinense in Amazon. Molecular characterization, using RFLP-PCR, ERIC-PCR and ISSR, was carried out initially for screening of morphologically similar isolates. Furthermore, phylogenetic analyses were performed using combined regions: Actin (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for the three isolates, INPA 2066, INPA 2286 and INPA 1858, plus superoxide dismutase (SOD2) for INPA 2066. We showed that the molecular markers were able to distinguish the isolates of Colletotrichum studied and these results were confirmed with the phylogenetic analyses, three different occurrences of Colletotrichum species (C. siamense, C. scovillei and C. brevisporum) causing anthracnose in C. chinense in the State of Amazonas. This study represents the first report of the species C. siamense and C. scovillei in this host in Brazil.

Introduction

Colletotrichum (teleomorph Glomerella), comprises a big range of cosmopolitan fungi species and are usually described as being the anthracnose disease agent. It is known ~600 species of the genus Colletotrichum, which are pathogens of over 3000 species of plants including cereals, legumes, vegetables, perenial crops, and tree fruits (O�Connell et al., 2012). There are some Colletotrichum species complexes already described in the literature, such as C. gloeosporioides, C. acutatum, C. boninense and C. orbiculare (Weir et al., 2012; Damm et al., 2012a,b, 2013). In Brazil, there are many reports of plant infection caused by Colletotrichum species, especially in economically important plants and fruits, such as coffee berries, sugarcane, strawberry, maize, sorghum, banana, avocado and many others. The tropical and subtropical climate favors the spread of Colletotrichum species on these plants.

It is notable the great economic interest of chili pepper (Capsicum chinense Jacq.) culture in many parts of the world. It happens because of its great potential of growth in almost every country, since it is a tropical regions native, and its use on food, pharmaceutical, cosmetic, and ornamental products (Dias et al., 2013). C. chinense is one of the most cultivated vegetables in Brazil, mainly in the North region. The anthracnose is a disease that more affects the culture and five species of Colletotrichum were described as the pathogen for this host, C. capsici and C. gloeosporioides in India, Indonesia, Korea, and Thailand, C. acutatum in Australia and Indonesia, C. coccodes in Korea and New Zealand (Ratanacherdchai et al., 2010) and C. brevisporum in Brazil (Almeida et al., 2017).

The identification of Colletotrichum based on morphological characters is problematic due to the few morphological traits that can be used to separate species in this genus (Than et al., 2008). Therefore, it is necessary a precise study and characterization based not only on morphological but also on molecular data utilized for species delimitation and defining of inter- and intraspecific relationships as it has been performed in the past decades. Several molecular techniques have been developed to characterize and to identify different Colletotrichum species. Multilocus phylogenetic analysis using partial sequences of gene such as actin (ACT), calmodulin (CAL), chitin synthase (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glutamine synthetase (GS), and manganese superoxide dismutase (SOD2) have been utilized to identify different species of this genus (Weir et al., 2012; Damm et al., 2012a).

Additionally, molecular markers are generally recognized as a reliable method to evaluate genetic diversity and differentiation of Colletotrichum spp isolates, such as restriction fragments length polymorphism (RFLP-PCR), inter-simple sequence repeats or microsatellites (ISSR) and enterobacterial repetitive intergenic consensus (ERIC-PCR). In the present paper, the objective was to differentiate and identify isolates of Colletotrichum collected from C. chinense in Amazon, northern of Brazil, using molecular markers and phylogenetic analysis.

Materials and Methods

Isolation of Colletotrichum from C. chinense

Fruits of chili pepper (C. chinense Jacq.) with typical anthracnose symptoms were observed in Manaus, Amazonas, Brazil.

The isolation was performed by collecting spores directly from the surface of the lesions in C. chinense fruit and then plated on PDA culture medium. A monosporic culture was performed to ensure that this work would be upon a single genetic uniformity.

The isolates of Colletotrichum selected and used for screening analysis (Figures 1, 2 and 3 Table 1).

Region Primers Sequences (5'-3')
Enterobacterial Repetitive Intergenic Consensus ERIC1 ATGTTAAGTCCCTGGGGATTCAC
Enterobacterial Repetitive Intergenic Consensus ERIC2 AGTAAGTGACTGGGGTGAGCG
Glutamine synthetase GSF1 ATGGCCGAGTACATCTGG
Glutamine synthetase GSR1 AACCGTCGAAGTTCCAC
Inter Simple Sequence Repeats UBC 885 BHBGAGAGAGAGAGAGA
Actin ACT 512 F ATGTGCAAGGCCGGTTTCGC
Actin ACT 783 R TACGAGTCCTTCTGGCCCAT
Superoxide dismutase SODglo2-F CAG ATC ATG GAG CTG CAC CA
Superoxide dismutase SODglo2-R TAG TAC GCG TGC TCG GAC AT
Glyceraldehyde 3-Phosphate dehydrogenase GAPDH-F GCCGTCAACGACCCCTTCATTGA
Glyceraldehyde 3-phosphate dehydrogenase GAPDH-R GGGTGGAGTCGTACTTGAGCATGT

Table 1. List of primers used for molecular screening and phylogenetic analysis.

Screening Colletotrichum isolates by molecular markers

To confirm if C. chinense, in the State of Amazonas, is host of different species of Colletotrichum, a initial screening on the obtained isolates was carried out only using different molecular profile isolates for phylogenetic analysis. For this screening, we used ERIC-PCR, ISSR and PCR-RFLP of GS (Glutamine sintase) intron techniques. For comparison, we used isolates of reference of C. fructicola, C. gloeosporioides and C. fragariae.

DNA extraction was carried out at the Molecular Biology Laboratory - Embrapa Western Amazon, according to Doyle and Doyle (1987). The primers used for amplification are listed in Table 2.

Species names Culturea Host/Substrate Origin GenBank accession No.b
GAPDH ACT SOD2
C. aenigma ICMP 18608* Persea americana Israel JX010044 JX009443 JX010311
ICMP 18686 Pyrus pyrifolia Japan JX009913 JX009519 JX010312
C. aeschynomenes ICMP 17673*, ATCC 201874 Aeschynomene virginica USA JX009930 JX009483 JX010314
C. alienum ICMP 12071* Malus domestica New Zeland JX010028 JX009572 JX010333
ICMP 18621 Persea americana New Zeland JX009959 JX009952 JX010308
C. communis (C. cf. siamense) GS01 Bauhinia variegata India KC790736 KC790622 -
GS06 Saraca indica India KC790739 KC790625 -
C. dianesei (syn. C. melanocaulon) CMM 4083 Mangifera indica Brazil KC517194 KC517298 -
Coll131 = CBS 133251* Vaccinium macrocarpon USA KP703275 - -
C. endomangiferae CMM 3740 Mangifera indica Brazil KC517298 KC517298 -
CMM 3814* Mangifera indica Brazil KC517298 KC517298 -
C. fruticola ICMP 18581*, CBS 130416 Coffea arabica Thailand JX010033 FJ907426 JX010327
ICMP 17921, CBS 238.49* Ficus edulis Germany JX009923 JX009495 JX010322
C. hebeiense SD452 Vitis vinifera China KF377505 KF377542 -
K3 Vitis vinifera China KF377495 KF377532 -
C. hymenocallidis(C. cf. siamense) CSSN2* Hymenocallis americana China - GQ856775 -
CSSN3 Hymenocallis americana China - GQ856776 -
C. murrayae (C. cf. siamense) GZAAS5.09538 Murraya sp China JQ247608 JQ247656 -
GZAAS5.09506 Murraya sp China JQ247609 JQ247657 -
C. musae ICMP 17817, IMI 52264 Musa sapientum Kenya JX010015 JX009432 JX010317
ICMP 19119, CBS 116870* Musa sp USA JX010050 JX009433 JX010335
C. nupharicola CBS 469.96, IMCP 17938 Nuphar lutea subsp. polysepala USA JX009936 JX009486 JX010319
CBS 470.96*, ICMP 18187 Nuphar lutea subsp. polysepala USA JX009972 JX009437 JX010320
C. queensalandicum ICMP 1778* Carica papaya Australia JX009934 JX009447 JX010336
ICMP 18705 Coffea sp Fiji JXX10036 JX009490 JX010334
C. salsolae ICMP 19051* Salsoa tragus Hungary JX009916 JX009562 JX010325
C. siamense ICMP 18578*, CBS 130417 Coffea arabica Thaliand JX009924 FJ907423 JX010326
INPA 2066 Capsicum chinense Amazonas, Brazil KY435611 KY435609 KY435613
C. siamense (syn. C. hymenocallidis) ICMP 18642, CBS 125378* Hymenocallidis americana China JX010019 GQ856775 JX010332
C. tropicale ICMP 18672, MAFF 239933 Litchi chinensis Japan JX010020 JX009480 JX010318
ICMP 18653, CBS 124949* Theobroma cacao Panama JX010007 JX009489 JX010329
C. acerbum CBS 128530, ICMP 12921, PRJ, 1199.3* Malus domestica New Zeland JQ948790 JQ949780 -
C. acutatum CBS 112760, STE-U 4468 Hakea sericea South Africa JQ948723 JQ949713 -
CBS 112761, STE-U 4461 Hakea sericea South Africa JQ948724 JQ949714 -
CBS 113599, STE-U 3038 Grevillea sp Australia JQ948678 JQ949668 -
C. australe CBS 116478, HKUCC 2616* Trachycarpus fortune South Africa JQ948786 JQ949711 -
CBS 131325, CPC 19820 Hakea sp. Australia JQ948787 JQ949777 -
C. brisbanense CBS 292.67, DPI 11711* Capsicum annuum Australia JQ948621 JQ949612 -
C. chrysanthemi IMI 364540, CPC 18930 Chrysanthemum coronarium China JQ948603 JQ949594 -
CBS 126518, PD 84/520 Carthamus sp Netherlands JQ948601 JQ949592 -
C. cosmi CBS 853.73, PD 73/856* Cosmos sp Netherlands JQ948604 JQ949595 -
C. costaricense CBS 330.75* Coffea arabica Costa Rica JQ948510 JQ949501 -
CBS 211.78, IMI Coffea sp Costa Rica JQ948511 JQ949502 -
C. cuscutae IMI 304802, CPC 18873* Cuscuta sp Dominica JQ948525 JQ949516 -
C. fioriniae CBS 129946, PT170, RB021 Olea europaea Portugal JQ948672 JQ949663 -
CSL 318 Magnolia sp UK JQ948676 JQ949667 -
C. godetiae IMI 381927, CPC 18935 Rubus idaeus Turkey JQ948769 JQ949759 -
CBS 862.70 Sambucus nigra Netherlands JQ948768 JQ949758 -
C. guajavae IMI 350839, CPC 18893* Psidium guajava India JQ948600 JQ949591 -
C, indonesiense CBS 127551, CPC 14986* Eucalyptus sp Indonesia JQ948618 JQ949609 -
C. johnstonii CBS 128532, ICMP 12926, PRJ 1139.3* Solanum lycopersicum New Zeland JQ948775 JQ949765 -
C. kinghornii CBS 198.35* Phormium sp UK JQ948785 JQ949775 -
C. laticiphilum CBS 112989, IMI 383015, STE-U 5303* Hevea brasiliensis India JQ948619 JQ949610 -
CBS 129827, CH2 Hevea brasiliensis Colombia JQ948620 JQ949611 -
C. limeticola CBS 114.14* Citrus aurantifolia USA, Florida JQ948523 JQ949514 -
C. melonis CBS119142, CMW 9931 Lupinus albus South Africa JQ948505 JQ949496 -
CBS 159.84* Cucumis melo Brazil JQ948524 JQ949515 -
C. nymphaeae CBS 129933, Goff99 Fragaria x ananassa USA JQ948592 JQ949583 -
IMI 348177, CPC 18890 Fragaria x ananassa USA JQ948593 JQ949584 -
C. paxtonii CBS 502.97, LARS 58 Musa nana “West Indies” JQ948616 JQ949607 -
IMI 165753, CPC 18868* Musa sp Saint Lucia JQ948615 JQ949606 -
C. phormii CBS 118197, AR 3389 Phormiun sp New Zeland JQ948781 JQ949771 -
CBS 483.82 Phormium tenax New Zeland JQ948782 JQ949772 -
CBS 118194, AR 3546* Phormium sp Germany JQ948777 JQ949767 -
C. pyricola CBS 128531, ICMP 12924, PRJ 977.1* Pyrus communis New Zeland JQ948776 JQ949766 -
C. rhombiforme CBS 129953, PT250, RB011* Olea europaea Portugal JQ948788 JQ948778 -
CBS 131322, DAOM 233253, C10, MS1L34 Vaccinium macrocarpum USA JQ948789 JQ949779 -
C. salicis IMI 345585, CPC 19376 Fragaria x ananassa New Zeland JQ948807 JQ949797 -
CBS 239.49 Unknown Unknown JQ948800 JQ949790 -
C. scovillei CBS 126529, PD 94/924-3, BBA70349* Capsicum sp Indonesia JQ948597 JQ949588 -
CBS 126530 Capsicum sp Indonesia JQ948598 JQ949589 -
CBS 120708 Capsicum annuum Thailand JQ948599 JQ949590 -
C. scovillei INPA 2286 Capsicum chinense Amazonas, Brazil KY435612 KY435610 -
C. simmondsii CBS 114494, STE-U 2964, STE-U 2964, STE-U 2088 Protea cynaroides USA JQ948613 JQ949604 -
CBS 111531, STE-U 2090 Protea cynaroides USA JQ948612 JQ949603 -
C. solanei IMI 364297, CPC 18929* Theobroma cacao Malaysia JQ948617 JQ949608 -
C. tamarilloi CBS 12814, T.A.6* Solanum betaceum Colombia JQ948514 JQ949505 -
CBS 129811, T.A.3 Solanum betaceum Colombia JQ948515 JQ949506 -
C. walerii CBS 125472, BMT (HL)19* Coffea sp Vietnam JQ948605 JQ949596 -
C. orbiculare CBS 133198, KTU-K6 Cucumis melo Japan KF178482 KF178555
C. brevisporum L57, LC0600, BCC 38876* Neoregalia sp Thailand JN050227 JN050216 -
BTL23, LC0870, MFLUCC 100182INPA 1858 Pandanus pygmaeusCapsicum chinense ThailandAmazonas, Brazil JN050228KX878887 JN050217KX878886 --
C. boninense CBS123755, MAFF 305972* Crinum asiaticum var. sinicum Japan JQ005240 JQ005501 -
ICMP 17904          
C. cliviae CSSS1 Clivia miniata China GU085867 GU085861 -
CSSS2 Clivia miniata China GU085868 GU085862 -
C. kahawae subsp. ciggaro (syn. Glomerella rufomaculans var. vaccinii) CBS 124.22*, ICMP 19122 Vaccinium sp USA JX009950 JX009536 -
C. karstii CBS 129833 Musa sp Mexico JQ005262 JQ005523 -
C. thailandicum HR01MFU, LC0596, BCC 38879* Hibiscus rosa-sinensis Thailand JN050231 JN050220 -
CMSP34, LC0958, MFUCC 100192 Alocasia sp Thailand JN050232 JN050221 -
C. trifolii CBS 128554, ICMP 12934, Medicago sativa USA KF178500 KF178573
C. tropicicola L58, LC0598BCC, 38877* Citrus maxima Thailand JN050229 JN050218 -
BTL07, LC0957, MFLUCC 100167 Paphiopedilum bellatolum Thailand JN050230 JN050219 -

Table 2: Strains of Colletotrichum spp used for phylogenetic analysis, with collection details and GenBank accessions.

To ERIC-PCR marker, ERIC1 and ERIC2 primers were used at a concentration of 0.2 �µM; 1X Buffer [100 mM Tris-HCl pH 8.8; 500 mM KCl, 0.8% (v/v)], 25 mM MgCl2; 0.5 mM dNTPs; 50 ng DNA; 1 U Taq polymerase (DNA Express�®), and reaction was set up to a final volume of 25 �µL. The programming on thermal cycler (Applied Biosystems VeritiTM96-Well Thermal Cycler) initiated with 94�°C for 1 min followed by 35 cycles of denaturation (94�°C for 1 min), annealing (48�°C for 1 min) and elongation (65�°C for 5 min) and further extension of 65�°C for 6 min.

To ISSR marker analysis, the PCR was performed at a 25-�µL final reaction volume, with 0.2 �µM of the UBS primer 885; 1X Buffer [100 mM Tris-HCl pH 8.8; 500 mM KCl, 0.8% (v/v)]; 25 mM MgCl2; 0.5 mM dNTPs; 50 ng DNA; 1.5 U Taq Polymerase (DNA Express�®). The pre-cycle was on 94�°C for 5 min, followed by 40 cycles of denaturation (94�°C for 1 min), annealing (45�°C for 1 min) and elongation (72�°C for 1 min), followed by a final extension at 72�°C for 7 min. Amplification of intron GS, PCR-RFLP was carried out according to Liu et al. (2012). All PCR and PCR-RFLP products ran at a 1.5% w/v agarose gel electrophoresis.

Phylogenetic analysis

Three loci were amplified by PCR and we used for phylogenetic analysis: ACT, GAPDH and SOD2. For these reactions, 1X Buffer [(100 mM Tris-HCl pH 8.8; 500 mM KCl, 0.8% (v/v)], 25 mM MgCl2; 10 mM dNTPs; 5 �µM for each primer; 50 ng/mL DNA; 5 U Taq Polymerase (DNA Express�®). The first cycle initiated with 94�°C for 4 min, followed by 35 cycles of denaturation (94�°C for 30 s), annealing (60�°C for 30 s) and elongation (72�°C for 1 min), followed by a final extension at 72�°C for 7 min. The primer sequences used for each gene are described in the Table 2. PCR products were purified and sequenced by the Applied Biosystems�® 3500 Genetic Analyzers. Sequences from forward and reverse primers were aligned to obtain a consensus sequence (Table 1). The fungal DNA sequences were aligned using MEGA 6 (Tamura et al., 2013) with reference sequences of the Colletotrichum obtained from GenBank. The Bayesian inference analyses employing a Markov Chain Monte Carlo method were performed with all individual and combined sequences. The MrModeltest 2.3 (Posada and Buckley, 2004) was used to determine the best model of nucleotide evolution (HKY+I to ACT; HKY+G to GAPDH; GTR+I+G to SOD2). The phylogenetic analysis was performed on CIPRES web portal (Miller et al., 2010) using MrBayes version 3.2 (Ronquist et al., 2012). Markov chain Monte Carlo method was run for 10,000,000 generations, sampling every 1000 generations and discarding 2500 samples as burn-in. The resulting trees were rooted using outgroup taxon. Trees were visualized in FigTree 1.4.0 (Rambaut, 2012) and exported to graphic programs. The sequences obtained in this study were deposited in GenBank (Table 2).

Results and Discussion

The results obtained reveal that simple molecular settings such as ERIC-PCR, PCR-RFLP and ISSR can be used with efficiency for screening of Colletotrichum isolates aiming to identify different species capable of causing anthracnose in the same host. ERIC-PCR and ISSR unique band profiles can be identified (Figures 1 and 2 Figure 3).

geneticsmr-Identification-Colletotrichum-isolates-Capsicum-chinense

Figure 1. ERIC-PCR of the three isolates from Capsicum chinense. A. Colletorihcum fructicola. B. C. gloeosporioides. C. C. fragariae. D. Isolate 2286. E. Isolate 2066. F. Isolate 1858.

geneticsmr-Identification-Colletotrichum-Capsicum-chinense

Figure 2. PCR amplification of ISSR of the three isolates from Capsicum chinense. A. Isolate 1858. B. Isolate 2066. C. Isolate 2286. D. Colletorihcum fructicola. E. C. fragariae. F. C. gloeosporioides.

geneticsmr-Identification-Colletotrichum-enzyme-digestion

Figure 3. PCR amplification of the 1-kb GS intron based on PstI enzyme digestion (RFLP-PCR), of the three isolates from Capsicum chinense. A. Colletorihcum fructicola. B. C. gloeosporioides. C. C. fragariae. D. Isolate 2286. E. Isolate 1858. F. Isolate 2286.

Phylogenetic results revealed that these different profiles correspond to different species of Colletotrichum associated with C. chinense (Figures 4, 5 and 6). This information could be confirmed by Bayesian inference methods from multiple gene sequences.

geneticsmr-Identification-Colletotrichum-Bayesian-inference

Figure 4. Phylogenetic tree generated by Bayesian inference upon a combinated ACT, GAPDH and SOD2 alignment sequences of Colletotrichum gloeosporioides species complex and the INPA 2066 isolate highlighted. This tree is rooted with C. boninense. Relevant bootstrap values are shown ate the nodes.

geneticsmr-Identification-Colletotrichum-Bayesian-inference

Figure 5. Phylogenetic tree generated by Bayesian inference upon a combinated ACT and GAPDH alignment sequences of Colletotrichum acutatum species complex among with the INPA 2286 isolate, highlighted. This tree is rooted with C. orbiculare. Relevant bootstrap values are shown ate the nodes.

geneticsmr-Identification-Colletotrichum-Colletotrichum-species

Figure 6. Phylogenetic tree generated by Bayesian inference upon a combinated ACT and GAPDH alignment sequences of Colletotrichum species including C. brevisporum among with the INPA 1858 isolate, highlighted. This tree is rooted with C. acutatum and C. scovillei. Relevant bootstrap values are shown ate the nodes.

Sequences from fragments of ACT, GAPDH and SOD2 from isolate INPA 2066, ACT and GAPDH from isolates INPA 2286, and INPA 1858 from C. chinense were compared with sequences from strains of other Colletotrichum species and it showed approximately 99% of similarity with Colletotrichum siamense, 99% of similarity with C. scovillei Damm, P.F. Cannon & Crous, and 96% of identity with C. brevisporum Phoulivong, P. Noireung, L. Cai & K.D. Hyde, respectively.

The combined dataset generated from Bayesian analysis shows similar topology with individual trees. In the phylogenetic trees based on combined dataset of ACT, GAPDH and SOD2 comprised 873 characters including alignment gaps, which showed that the isolate INPA 2066 is closely related to C. siamense H. Prihastuti, L. Cai & K.D. Hyde. This tree was rooted to C. boninense (Figure 4). C. siamense is biologically and geographically diverse, found in many hosts across several tropical and subtropical regions, including Capsicum annuum in Thailand (Weir et al., 2012). Recently, Sharma et al. (2015) using multilocus analysis demonstrated that C. siamense are four distinct species forming the C. siamense species complex.

The analysis of the combined dataset of ACT and GAPDH showed that the isolate INPA 2286 formed a monophyletic clade supported (Bayesian posterior probability = 0.87) with three strains of C. scovillei (Figure 5). And isolate INPA 1858 formed a monophyletic clade with high support (Bayesian posterior probability = 1) with two isolates of C. brevisporum (Figure 6). The trees were rooted to C. orbiculare, and two species from each complex (C. acutatum and C. scovillei), respectively (Figures 5 and 6). Colletotrichum scovillei belongs to C. acutatum species complex and was associated with chilli in Indonesia and Thailand (Than et al. 2008; Weir et al., 2012).

In Brazil, the first report of anthracnose on pepper fruit (C. annuum L.) caused by C. scovillei was by Caires et al. (2014). Colletotrichum brevisporum, which is still not inserted in any Colletotrichum species complex has been reported in Neoregalia sp and Pandanus pigmaeus in Thaliand (Noireung et al., 2012). In Brazil, it has been notified the presence of this pathogen in papaya fruit (Vieira et al., 2013), chaoyte fruits (Bezerra et al., 2016) and chili pepper (Almeida et al., 2017).

In the present study, we showed that the molecular markers were able to distinguish the isolates of Colletotrichum studied through the different band profiles and was possible to differentiate isolates of the C. gloeosporioides and C. acutatum species complex. The phylogenetic analysis results confirmed the occurrence of C. siamense, C. scovillei and C. brevisporum causing anthracnose in C. chinense in the State of Amazonas.

This study represents the first report of the species C. siamense and C. scovillei in this host.

Conflicts of interest

The authors declare no conflict of interest.

Acknowledgments

p>The authors thank Fundação de Amparo à Pesquisa do Estado do Amazonas
(FAPEAM) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for
scholarships.

About the Authors

Corresponding Author

G.F. da Silva

Laboratório de Biologia Molecular, Embrapa Amazônia Ocidental, Manaus, AM, Brazil

Email:
gilvan.silva@embrapa.br

References

  • Almeida LB, Matos KS, Assis LAG, Hanada RE, et al. (2017). First report of anthracnose of Capsicum chinense in Brazil caused by Colletotrichum brevisporum. Plant Dis. 101: 1035. https://doi.org/10.1094/PDIS-01-17-0099-PDN
  • Bezerra JP, Ferreira PV, Barbosa LF, Ramos-Sobrinho R, et al. (2016). First report of anthracnose on chayote fruits (Sechium edule) caused by Colletotrichum brevisporum. Plant Dis. 100: 217. https://doi.org/10.1094/PDIS-07-15-0793-PDN
  • Caires NP, Pinho DB, Souza JSC, Silva MA, et al. (2014). First report of anthracnose on pepper fruit caused by Colletotrichum scovillei in Brazil. Plant Dis. 98: 1437.https://doi.org/10.1094/PDIS-04-14-0426-PDN
  • Damm U, Cannon PF, Woudenberg JHC, Johnston PR, et al. (2012a). The Colletotrichum boninense species complex. Stud. Mycol. 73: 1-36.https://doi.org/10.3114/sim0002
  • Damm U, Cannon PF, Woudenberg JH and Crous PW (2012b). The Colletotrichum acutatum species complex. Stud. Mycol. 73: 37-113.https://doi.org/10.3114/sim0010
  • Damm U, Cannon PF, Liu F, Barreto RW, et al. (2013). The Colletotrichum orbiculare species complex: Important pathogens of field crops and weeds. Fungal Divers. 61: 29-59. https://doi.org/10.1007/s13225-013-0255-4
  • Dias GB, Gomes VM, Pereira UZ, Ribeiro SFF, et al. (2013). Isolation, characterization and antifungal activity of proteinase inhibitors from Capsicum chinense Jacq. Seeds. Protein J. 32: 15-26. https://doi.org/10.1007/s10930-012-9456-z
  • Doyle JJ and Doyle JL (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11-15.
  • Liu B, Louws FJ, Sutton TB and Correll JC (2012). A rapid qualitative molecular method for the identification of Colletotrichum acutatum and C. gloeosporioides. Eur. J. Plant Pathol. 132: 593.https://doi.org/10.1007/s10658-011-9904-1
  • Miller MA, Pfeiffer W and Schwartz T (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Proceedings of the Gateway Computing Environments Workshop (GCE). New Orleans LA, USA.
  • Noireung P, Phoulivong S, Liu F, Cai L, et al. (2012). Novel species of Colletotrichum revealed by morphology and molecular analysis. Cryptogam., Mycol. 33: 347-362. https://doi.org/10.7872/crym.v33.iss3.2012.347
  • O’Connell RJ, Thon MR, Hacquard S, Amyotte SG, et al. (2012). Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses. Nat. Genet. 44: 1060-1065. https://doi.org/10.1038/ng.2372
  • Posada D and Buckley TR (2004). Model selection and model averaging in phylogenetics: advantages of akaike information criterion and Bayesian approaches over likelihood ratio tests. Syst. Biol. 53: 793-808.
  • Rambaut A (2012). FigTree version 1.4.0. Available at [http://tree.bio.ed.ac.uk/software/figtree].
  • Ratanacherdchai K, Wang H, Lin F and Soytong K (2010). ISSR for comparison of cross-inoculation potential of Colletotrichum capsici causing chilli anthracnose. Afr. J. Microbiol. Res. 4: 076-083.
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, et al. (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61: 539-542. https://doi.org/10.1093/sysbio/sys029
  • Sharma G, Pinnaka AK and Shenoy BD (2015). Resolving the Colletotrichum siamense species complex using ApMat marker. Fungal Divers. 71: 247-264. https://doi.org/10.1007/s13225-014-0312-7
  • Tamura K, Stecher G, Peterson D, Filipski A, et al. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30: 2725-2729. https://doi.org/10.1093/molbev/mst197
  • Than PP, Jeewon R, Hyde KD, Pongsupasamit S, et al. (2008). Characterization and pathogenicity of Colletotrichum species associated with anthracnose on chili (Capsicum spp.) in Thailand. Plant Pathol. 57: 562-572. https://doi. org/10.1111/j.1365-3059.2007.01782.x
  • Vieira WAS, Nascimento RJ, Michereff SJ, Hyde KD, et al. (2013). First Report of Papaya Fruit Anthracnose Caused by Colletotrichum brevisporum in Brazil. Plant Dis. 97: 1659.https://doi.org/10.1094/PDIS-05-13-0520-PDN
  • Weir BS, Johnston PR and Damm U (2012). The Colletotrichum gloeosporioides species complex. Stud. Mycol. 73: 115-180. https://doi.org/10.3114/sim0011

Keywords:
Download:
Full PDF